let's make the new .io game:
how would it be?
what would it have?
Qt traps
>.io
i've got a decent idea
it would be like slither.io
but without lag
that diep.io or whatever is garbage
Agar is shit too
the only good .io is Slither.
Wings too.
>>334723346
>dev getting desperate for ideas to make a new hit reddit game
>>334723346
Wings.io faggot
dna sequencing into protein inside a cell. Type in a random sequence i.e. GGACTACGGCTACGCATTTCAGACT, turn it into RNA, make that into a protein and see how it affects the cell. for simplicity just keep to a 5 letter max i.e. GGCTA or something. After that, I dunno.
Okay guys I got it.
It would be like slither
but instead of snakes
its dicks
oi.io
something with mirrors
>>334723834
this basically exists but i forget what it was called
>>334724002
I think i know what you're thinking of but it's not that ahahhaha
>>334724002
>>334723834
genital jousting
>>334724105
PENETRATION.
Isn't that supposed to come out this month?
>>334723346
We bring back Voar
a platformer where you climb a tower and you can knock other people off
top scores would be whoever is on the highest floor (infinite floors)
Rape game where you have to chase down and rape other anons but you dont kill them.
>>334724374
holy fuck you just completed my game I only needed some kind of progression
that's it!
get higher in a ramp
a game where you look for a cookie and you find it
>>334723346
a game that's somewhat skill-based where your rank isn't just a function of long you've been playing.
basically wings.io
>>334724374
this plox
>>334724481
make them lolis too!
Here's an idea
You're an asteroid who goes around crashing into other space rocks to add them yourself. As you get bigger your gravitational field increases and things start getting drawn into you. If something much smaller than you crashes into you, you get bigger. If something about your size crashes into you, the two of you split apart and have parts of you scattered as debris. If you crash into something much larger than you, you lose and have to restart.
>>334724374
>>334724523
Looks like we may have our next .io creator as well.
>>334724374
>vertical platformers
Am I intended to pronounce these things like "Agar-ee-yo" or "Agar-dot-eye-oh" or "Agar-eye-oh?"
>>334724374
tower.io
>>334723346
pol.io
you start as a bluepill. you eat conspiracy nuggets to grow and kill other bluepills to become to ultimate redpill
A game where the goal is actually to get smaller instead of bigger.
>>334723346
>Is another dev pretend to be innocent anon, but just here to steal idea, and saying it was his own after earning a good buck episode.
>>334724764
Just Agar. Or the first one.
>>334724764
Just "agar"
>>334724764
I pronounce them as a single word, ie Slitherio, or Agario. People getting angry about it and telling me this is wrong only makes me happier I'm pronouncing them like that.
>>334724990
That's how I pronounce them too.
>>334724990
This.
>>334724764
"blob game" and "snake game"
>>334723756
>GGACTACGGCTACGCATTTCAGACTCCTAATCGGACTCTAATCTCGGAGCTAC
RNA
>GGACUACGGCUACGCAUUUCAGACUCCUAAUCGGACUCUAAUCUCGGAGCUAC
Protein code
>GLRLRISDSSDSNLGA
Pic related, your protein. Don't know why you wanted this but ok.
>>334724643
>>334724374
I'm wet.
meme.io
whoever has the dankest maymay wins and gets upvoted on reddit and their ip address sent to facebook.
Why is diep so slow all of a sudden
>>334724643
So agar plus gravity.
>>334724990
But it's to do with the fact that it's supposed to be a petri dish with agar as a nutrient.
>>334723346
>STRAIGHT UP JUST ASKING /v/ TO MAKE YOUR GAME FOR YOU
You lazy fucks have gone too far this time
>>334725680
just do it
it's not like you worthless fucks will do anything better with your lives
slither>agar>>>>>>>>>shit>diep
It's a shame terratech wont get a multiplayer mode that operates like agar.io
Starting off as a tiny vehicle and slowly killing and stealing parts of other people's vehicles to grow in size seems to fit the bill pretty well
a page with an embedded video of the faggot who makes these games killing himself
one that has sadpanda lock so it'll never sell out to miniclip
>>334724374
What's the incentive to knock other people off?
How does lower floors catch up to top guy?
>>334726146
>Not wanting Panda.io
>It's just a Sad Panda Simulator
God you people are miserable cunts.
Why the fuck does it bother you so much that someone's making money off of games and using /v/ as a tool to fix the issues in the game? Every single one of us would do the same thing if we could and I think it's smart.
Yeah the games are a bit copy/paste, but that's because the format works well.
How about you make the same game only with proper coding so that the server doesn't run like complete shit?
I mean it's not that hard, if a monkey from Brazil can do it, I don't see why you can't.
>>334723346
whats the deal with these .io games
why am i seeing this shit everywhere
>>334723435
So fagg.io?
>>334726146
I have always wanted to make a team based loli beat em' up. sad panda lock would be perfect for that.
>>334723346
Well obviously Aster.io, an MMO asteroids.
>>334726335
>>334726306
Because it'sfun
How about an io game where everyone needs to work with each other instead of against? Or maybe you're randomly assigned to a team.
>>334726241
I'm not fleshing out the idea for you, it's just a basis
>>334726306
Some guy from the third world finally made a game that sold like 150m units, and now Pajeets from all over the rest poor countries of the world are trying to make clones.
>>334726247
but diep.io is shit, anon
I remember playing some flash game 6-8 years ago similar to diep.io but not multiplayer.
You build a ship out of blocks that are different guns and engines, or attach guns and engines to plain body blocks or some shit.
You structure it however you want by dragging blocks around and connecting them to your main body.
Opponents are killed or partially blown apart and drop some of their blocks when that happens which you can use on yourself.
Make that.
Or at least someone tell me what game I am thinking of.
>>334726532
>sold
what?
>>334723346
I will make the logo.
>>334726335
Isn't that the scooter name in GTA?
shitpost.io
You compete with others to make the biggest shitpost. Everytime you get a (you) your neckbeard grows longer. You eliminate other players by using greentext and smug anime faces.
>>334726745
That already exists.
>>
It's shit tough, so don't bother.
>>334726745
I dunno why, but this gave me an idea.
>4Chan the Card Game
>It's a tactics party game where you have to flame, enrage, make alliances with, and post reaction images to each other.
Fug.io
>>334726846
That's awful.
We wuz kangz Wildkat
>>334726846
>post reaction images
good idea
>>334726360
You guys want to make this?
We just need some excellent netcode, a massive server, and 500 people testing each design iteration simultaneously.
>>334727076
Well, if you need testers, I can definitely contribute.
>Random fag who actually likes to jump into a wall for 4 hours to see if I glitch through
>>334726846
Will you be able to post misnamed reaction images for derailing threads?
Will there be dubs?
>>334726360
so diep.io?
>>334725245
>rna
>t
dont do this anon
>>334726608
Captain Forever.
There's also a similar game jagex made that's multiplayer.
http://www.funorb.com/g=voidhunters/info.ws?game=voidhunters
Unfortunately the site is pretty much abandoned.
>>334727263
Event card:
>Check'em
All players may immediately play any card and if its #, lower right, ends in doubles or more of a number, all opponents must post a reaction image or drop out of the match.
As for mismatched names, maybe. Can't see how it'd work on cards. Maybe calling the wrong name or something.
>>334727410
>Captain Forever
That's it.
Thanks m8
>>334727269
Maybe, haven't played that.
What makes the good io games good is that there's building your character while competing with other characters, showing how you have progressed to others and then being able to completely fuck other players over or them completely fucking you over.
That's the core of both agar and slither, and they're both great
>>334726608
Was it a shmup?
Did everything look like it was made of toy blocks?
>>334728195
http://www.captainforever.com/captainforever.php
>>334727269
After having played for a few minutes: No. That really isn't anything like Asteroids.
>>334723624
Agar was cool, Slither is also cool but the lag kinda kills it sometimes. Wings was the best until they changed the FOV. Also Voar was pretty good. But I agree, Diep is total shit.
why is everyone here so against diep? cant realy play it right now since doing something else on the pc, but why ?
from what I seen, its kinda cool.
>>334729113
Unbalanced as shit. Only two, or you can argue one, tank class is viable while everything else is shit or niche.
Too fucking slow with awful POV. Stray bullets that OHK you come out of nowhere and just touch you when you're a low level so many times.
And even more. Hopefully the Dev is competent enough to fix and consider changes suggested by /v/
>>334723346
Let's breakdown what makes the popular ones popular.
>PVP
>leaderboard
>reasonable ways that allow longer/bigger players to be killed besides being already above them
>multiple people can capitalize off of one large death
>starting small
>getting big
>>334729113
Balancing issues.
Snowballing.
Finite levels.
Low level is grind on non-moving 'pve'.
Leaderboard is won by shitting on low levels.
>>334729413
which is the op one? Machine or Sniper?
>>334729498
Not him but I'd vote sniper
No idea, but I'd make sure to include a JS bitcoin miner.
>>334729498
Triplet is arguably the best gun, however maxed Machine can also be consider top tier and completely towers over any other class that is not Triplet.
Honestly, anything that is not Triplet or Machine is playing with a handicap.
And Sniper got nerfed. It's complete trash now.
What was that orbit .io game?
BRING BACK VOAR
>>334723346
shill.io
you try and shill your garbage brazilian shovelware to 4chan and reddit at the same time while others try to outshill you and make more money
>>334729917
That actually sounds kinda fun.
War.io
As soon as you enter you are pitted in a multiplayer warioware-esque game, the first to complete the minigame wins a point, there's a leaderboard
V O A R
O
A
R
JUST MAKE A FUCKING KNOCK-OFF CLONE GOD DAMNIT I KNOW IT CAN'T BE THAT FUCKING HARD TO HAVE SIMULATED ORBITING GRAVITY REEEEEEE
I would pay $5 for a version of Ace of Spades that had a competent developer.
The perfect version would be extremely similar to the build right before they removed auto climbing and added the SMG. (0.32?)
If you added proper resolution support, volumetric voice chat, proper mouse sensitivity controls, melee weapons, a server browser, and larger map+player sizes, it would be perfect. PERFECT!
I guess OpenSpades will do for now. But you can't really play on the old, better versions. And every server is modded to hell and back.
Come now children, lets think of all the good times we had with /v/'s flavor of the month game back in 2011
Is it like an unspoken rule with these games that the camera has to be so zoomed in you can barely see your own character
>>334730219
*added auto climbing, I meant
Autoclimbing killed the game.
>>334723346
bring back Voar
vore.io
You eat snakes n' stuff
>>334730325
>zoomed in
>in
>Can't see character
diep might be unpolished as fuck, but it still shits all over slither
both of them are memegames trying to tap into agar's success though
>>334723346
TAK.ion
>>334730793
>both of them are memegames trying to tap into agar's success though
why do people give a shit about who's making money on what? As long as I get fun games to play, that's all that matters.
>>334730325
don't worry my friend the game that is coming is going to be 3D using webGL and will be camera free, 500 players in one map, can't say more details
>>334730793
slither is the best one. it's the simplest design, the most balanced and looks the best. the only real problem is poor optimisation.
i hope somebody makes a true light cycles game. lightcycles.io or something. slither is OK but it's not light cycles
>>334729760
voar.io
It's dead.
>>334724990
>I like being ignorant
Well, you sure showed somebody, amiright?
>>334723346
> games
they honestly resemble screensavers more than games
>>334730119
Please make it happen
>>334724242
>>334728425
>>334729832
>>334731853
>>334730461
>Voar
The only good .io game and the fucker ditched it
cursors.io and wings.io are the best ones, prove me wrong.
cursos was the only one that was actually clever and fun
everything else is just mindless clickbait
>>334732837
>>334732817
was cursors the one where you cuck other people and make them open doors for you?
>>334733198
Yes
>>334726461
cursors.io is very good for the cooperation needed
just port some good 90's DOS game multi or a known "phone" default game multi and make it .io
I don't understand cursors
>>334723346
Like a fightan. Jab, stong, fierce. Uhhhhhhhhh idk about different move speeds and such. Maybe build up LOTS of points to change attacks. Different gameplans, but still gives people a chance to find out your moveset.not overpowering because its replacing one with another, still rewards the player for being good.
How would the player controlled model thing look like? An octogan with vertices the elongate when it attacks?
So everyone knows the best one is wings.io, right?
There aren't any retards here who disagree with that notion, right?
>>334723346
Some kind of game where movement is by slinging around/flinging your avatar like a frisbee.
You're only vulnerable when landing, and only when an inner circle rests on top of another do they kill.
Larger you get, the longer your cooldown until you can move again.
>>334724374
>>334726241
I think it should be a horizontal platformer with a finish line that has platforming mini zones equal to 5x your level, whenever you make it to the finish line you level up and are returned to the 1st zone + your level repeat ad nauseum.
Each time you level up you can put stat points into things like run speed, jump height, jump damage, push strength, health etc. You can kill other players by goomba stomping them to death or pushing them into the abyss.
When you kill a player you automatically advance zones equal to (Killer level - Victim level)5 + Victim level.
cursors is fun as fun
thanks for mentioning it anons
wing.io is too easy even for me
I made some kind of a HTML5 game a while back. It's turn based tho...
http://46.101.214.124:8080/
>>334736602
link looks legit
Make a game where everyone has a pool ball and every few seconds after everyone stops the game taps everyone's ball in the direction their cursor points.
Only have a set number of people in each lobby.
Players are eliminated when they are knocked into holes on the field until they start a new round.
The less people on a field, the harder the balls are hit.
Rounds should be short and sweet.
>>334724374
>Mechanic is a dashing grab, which lets you pick players or blouders and toss it at other players or to the void
>To get to the next floor you need to climb a fuckhuge step, which takes time
>Meanwhile anyone can reach out to you and toss you away
>The people at the highest floor cant ascend another floor without sacrificing anyone to gravity
>You can descend floors
>>334726608
shoot shoot nitori: the golden
>>334724374
there would need to be some kind of rubber banding though, or else someone could take an insurmountable lead
Massive soccer game with a ball for every 6 players
>>334726608
Tsumiki fighters.
one where you sit on a computer all day on a video game board NOT talking about video games
>thief.io
>the arena is covered in gold coins that you pick up and put in your bag
>the more coins, the higher the score
>you can throw gold as projectiles at another player to damage kill them and take their coins
>the more you gather, the slower you move
>noobs can move fast, but have limited projectiles
>advanced players move slower, but can spam projectiles
>>334738809
That sounds hella fun
>>334723346
I want the ACTUAL snake game but multiplayer,
no passing through yourself bullshit
no eating other snakes
and most importantly, no fucking super speed, it's stupid and defeats the purpose of the game, you are supposed to outwit your opponents, not outlag them damn it
https://www.youtube.com/watch?v=3PX6HfzMGyU
>>334739720
There needs to be a sense of progress though
bring back voar.io
SPACEORBITS
I want more realism and space combat that's to do with actual orbital mechanics
>>334735781
Thougt some more on this.
>be octogan
>move with wasd
>have light, medium, and hard attacks
>attack using wasd + mouse1, mouse2 and space bar
>killing gives points
>points can be spent on different attacks
This is very expensive
>you can purchase a cosmetic belt for a round using points
>bounties can be given to multiplie players to hunt you down
>The bounties and purchases act as incentives
>replacing moves prevents the better player from becoming to powerful
>varying attacks allows for the player to throw off their bounty hunters
>vice versa
A meta game insues
Its a game about the election
Call it rub.io
>>334726608
There is Bubble Tanks 3, but I don't think it is what you are looking for.
Its basically diep with bubbles and single player, on the third game they made a editor so you can build whatever way you want, but the amount and quality of blocks are limited by your level.
>let's make a new .io game
>aka: give me more game ideas you stupid fucks so I can monetize it and make millions
Literally a cuck thread.
>>334724374
>>334724789
Holy shit this could actually work.
>>334729413
>Hopefully the Dev is competent enough
The problem is not that he's incompetent.Not that I doubt he is. It's that he has no interest in making improvements for himself or his game in terms of quality, he just wants to gather general points of interest to make his game profitable and make money off of it then move on to the next big thing.
Hotline Miami style free for all
>orbit.io
>you're a planet that orbits your mouse
>you collect space debri to grow larget
>you can launch debri to damage players slightly to steal their mass
>the more mass you launch the faster you shrink, but you also damage your opponent more
>your debri orbits you and the mouse
>>334743297
Need need need. I'm a sucker for planet makers. But it's little too similar to agar.
>>334743973
Slither is even more similar, what makes those games fun is the collection of materials and then using it to your advantage
