[Boards: 3 / a / aco / adv / an / asp / b / biz / c / cgl / ck / cm / co / d / diy / e / fa / fit / g / gd / gif / h / hc / his / hm / hr / i / ic / int / jp / k / lgbt / lit / m / mlp / mu / n / news / o / out / p / po / pol / qa / r / r9k / s / s4s / sci / soc / sp / t / tg / toy / trash / trv / tv / u / v / vg / vp / vr / w / wg / wsg / wsr / x / y / ] [Home]
4chanarchives logo

What does /g/ think about bioinformatics? I am currently considering doing an MSc


Thread replies: 21
Thread images: 1

File: bioinformatics.gif (18KB, 260x272px) Image search: [Google] [Yandex] [Bing]
bioinformatics.gif
18KB, 260x272px
What does /g/ think about bioinformatics? I am currently considering doing an MSc in Bioinformatics. I've talked with the professor in charge of the course and they apparently do a lot of programming (mostly R, Python, and Perl), statistics, and HPC stuff.
>>
i find it super boring
>>
>>53578546
it's pretty fucking cool. lots of opportunities there now that CRISPR is a thing.
>>
for x in acttgcatgtactgactcagtcagta . . .

/thread
>>
>>53578577
>lots of opportunities there now that CRISPR is a thing

That's not really bioinformatics.
>>
It's very useful, especially if you're doing a lot of work with proteins. However, i'd probably get bored of it too quick.
>>
>>53578562
Are you studying/practising it?

>>53578577
>>53578633
Reading about that it seems more like molecular biology.

>>53578669
The way the professor described it it seemed like there was a huge variety in the bioinformatics from microbiology, through genomics, genetics, to proteomics and other sub-fields. He joked that most biologists are computer illiterate and need help with everything.
>>
It's cool but it's gonna be another meme degree flooded with people looking for money not interested in learning the actual material.
>>
>>53578906
I wonder about that, most meme degrees are undergraduate level while most bioinformatics courses I've seen were postgraduate, and so is the one I'm considering..
>>
I'm in Bioinformatics in the south

Godliest of the god tier field m8
>>
>>53579541
>Godliest of the god tier field m8
Sounds good, any particulars?
>>
It's just stats in the domain of biology. Only do this course if you did an undergrad in biology or something. If you did an undergrad in CS, there are way better masters.
>>
Seems interesting as fuck, really have the potential to make a difference.
>>
I finish my undergrad in chemical engineering in a month. I'm trying to decide between med school and law school. Leaning towards law desu, what do you guys think?

Should I work in engineering, get my professional engineering license and then go back for something else?
>>
>>53579960
dude, do not go to fucking law school you will just end up a pleb with massive debt.
>>
>>53580220
But it's free for me since I'm disabled.
I have ADHD and I hurt my spine in a mountain biking accident a few years back, pretty much recovered but I like to milk it for the benefits.
>>
>>53580713
I hope my lawyer is never an ADHD spastic.
>>
>>53579913
Mmm, no. I have a BSc in Microbiology, Msc in Biotech and PhD in Biomedical Science. I wish I know how to program. You won't believe the rickety Rube Goldberg Excel script that we have as our pipeline for processing gene sequences. We need more programmers in the life sciences.
>>
>>53578879

Same. One of my comp sci profs who works on bioinformatics algorithms now (contig alignment and such) said that the code and algorithms that biologists produce is laughable. They'd be dead in the water if it weren't for computer scientists.
>>
>>53582762
Samefag here.

The field itself is really interesting. Most of it is Big Data - analyzing genomes, annotating them (what sequence does what), also population comparisons (did a group of people who died of heart attack have a common mutation?).

Another big part of it is aligning sequence data. The way we sequence a strand of DNA today is such that it produces a bunch of small, overlapping fragments which then have to be aligned to form the whole segment. That takes a lot of high performance, distributed computation and highly optimized algos.

Another big field is simulation. Literally simulating a protein and seeing how they interact with drugs, other proteins etc. The limiting factor here is processing power. That's why BOINC has a lot of such projects. I swear the day we get quantum processors, we're just gonna be able to brute force our way into curing a lot of diseases.

Tldr: high performance computing, big data
>>
85% of bioinformatics is converting shit from one format to another. Anyone who tells you differently hasn't actually worked in bioinformatics
Thread replies: 21
Thread images: 1
[Boards: 3 / a / aco / adv / an / asp / b / biz / c / cgl / ck / cm / co / d / diy / e / fa / fit / g / gd / gif / h / hc / his / hm / hr / i / ic / int / jp / k / lgbt / lit / m / mlp / mu / n / news / o / out / p / po / pol / qa / r / r9k / s / s4s / sci / soc / sp / t / tg / toy / trash / trv / tv / u / v / vg / vp / vr / w / wg / wsg / wsr / x / y / ] [Home]

All trademarks and copyrights on this page are owned by their respective parties. Images uploaded are the responsibility of the Poster. Comments are owned by the Poster.
If a post contains personal/copyrighted/illegal content you can contact me at [email protected] with that post and thread number and it will be removed as soon as possible.
If a post contains illegal content, please click on its [Report] button and follow the instructions.
This is a 4chan archive - all of the content originated from them. If you need information for a Poster - you need to contact them.
This website shows only archived content and is not affiliated with 4chan in any way.
If you like this website please support us by donating with Bitcoin at 1XVgDnu36zCj97gLdeSwHMdiJaBkqhtMK