Women hate thread. New content appreciated.
- Home
- Board: /r9k/ - ROBOT9001
- Reading: Women hate thread. New content appreciated.
Women hate thread.
New content appreciated.
>education
>ambition
>job
But only women and nu-males look for that shit in a potential partner.
>>29905451
I got you, desu phampai
>>29905719
Let the dumping commence!!!!!
>>29905727
Roasties need to leave immediately REEEEEEEE
>>29905736
This post is without a doubt original woman hate
>>29905752
Contribute, lads! Keep her goin'!
>>29905764
Woman hate bread is the only thing that still keeps the normie and roastie scum at bay!
pussy values more than education, job and all you counted.
>>29905789
Come on, I'm running out of hate. I can't be the only one
>>29905451
I'm too lazy to post images right now.
Women are horrible, vile creatures.
>>29905806
EXTERMINATE THE ROASTIES
MAKE R9K GREAT AGAIN
>>29905826
RIIIIIIIIIIIIIIII
FUCK OFF ROBOT THIS CONTENT IS ORIGINAL
>>29905853
This dump is coming to an end. Who will take up the legacy of woman hate bread?
>>29905752
>wizard uprising
I can't wait for this to happen
>>29905872
DAILY REMINDER THAT ROASTIES ARE NOT PEOPLE, THEY CANNOT UNDERSTAND KINDNESS OR LOYALTY LIKE HUMAN BEINGS
>>29905902
Soon, brother! But until that glorious day, we must keep the normies off our board. And to do this we must keep woman hate bread going!
REEEEEEEEEEE
>>29905940
They are shallow twats with no dignity or decency!
>>29905962
Well, robots, I did my best. I wish you good fortune in the wars to come
Posted it in the previous thread, but it was already past bump limit and on page 10, so I'm posting it here again: Some bitch who crowdfunded her attendence to a conference where she talked about how hard women are having it in tech, omitting the fact that the men who are supposedly against her and making her life difficult threw money at her.
>200+ images in women-hate folder
>still worship insta-qts
One for all you white knights and aspiring beta providers out there. Here's to you.
And another, to those who think gender roles are fluid.
>>29906022
fucking roasties i swear. im not sure which is worse these roasties or the fucking beta cucks who give her money. this is it boys, the end of western civilization, prepared to be cucked into the next century.
Can you just shut up? Kid, no one besides insufferable copies of you cares who you hate. God, you'd think that someone could figure out why they're so miserable, especially when they spend all day alone with themselves. Has it ever occurred to you that, if born with the same genetics in the exact same environment, you'd be the exact same. People you hate don't have the same mindset as you of what's right and what isn't but they continue to do what's wrong. But no, it won't matter. Just continue ruining yourself everyday with your opinions and justifications.
>>29905451
we've had a woman hate thread today, this is boring now. stop being an attention whore op
>>29905962
>>29905940
What is this skeleton man meme. I like it.
>>29906022
PORTLAND OREGON
Every fucking time
>>29906102
lol roastie getting mad. you're gonna die one day, why stay so upset?
>>29905736
most women don't like chivalry either way
>>29906102
Yeah, uhuh, thats really hlw you feel?
Hmmmm....
>>29906102
Toasty roastie posting shite,
in the 4chans of the night;
what immoral hand or eye,
could frame thy insufferable faggotry?
>>29906158
>knows most women
>>29906148
>>29906166
>>29906174
>taking the bait and giving """"her"""" attention
baka
>>29906255
baka? wtf, fucking robot, i put s m h (shaking my head) not baka
>>29905451
>Fake tits
>Fake nails
>Fake lashes
>Wants a real man
>>29906102
tits or gtfo cumdumpster
i want a sharpy in pooper too
>>29906255
I get far to excited when I spy a roastie getting toastie...
>>29906148
>>29906166
>>29906174
Did it feel good to get that out? I'm sure you felt pretty good, you're in the majority here anyway. Can't feel like that forever. Soon you'll be depressed and empty again at night.
Now go ahead and type you're smug comment while you have zero expression on your face.
>>29906332
>Your
Fixed that for you :^)
>>29906332
Women are just useful idiots and were given voting rights to keep the democrats in power and fuck over everyone(specially) blacks so they can sit back and laugh
We're going to take women's rights and put them back on their leashes so we and our descendants can be fucking happy for once
>>29906332
oh god roastie, that's the stuff.
>>29906332
tfw asexual and have a pretty good life
yeah, it feels pretty good when you assume things.
>>29906410
You'll never be happy. There's something mentally wrong with you, albeit you're too egotistical and arrogant to realize it. You'll just blame the world for everything.
>Why don't these other people think exactly like I do why isn't everything in order
Do have fun with that revolution. You'll get off here and get too it someday, I'm sure.
>>29905451
>encouraging women to get "educated" aka feel entitled to men's work while hating men
Coulda said something actually good like fun hobbies, a pleasant personality, loyalty, or cooking skills.
>>29906332
its gettin hot in here
so take off all your clothes
tits
or
gtfo
>>29906485
>pretty good life
posts an image with a face that just says "i hope i never wake up after drinking this bottle of cheap alcohol"
>>29906332
>>29906491
Is that how you really feel? Interesting.
Hmmm....
>>29906452
>expressionless face and minimal chemical change
>"oh god roastie, that's the stuff"
>>29905451
I'll post a few woman hate images.
>>29906102
>Can you just shut up? Kid, no one besides insufferable copies of you cares who you hate.
Right back at you, desu.
>>29906370
usually i strongly dislike comics with simple premises like "lul kids spell santa wrong" but the line "those dyslexic kids are at it again!" is too endearing and chuckleworthy not to love it
>>29906332
thats the spirit keep proving us right, roastie.
Woman are just as privileged as they say men are.
I feel like we're even with privilege.
>>29906611
>>29906574
The problem is that you think this isn't more entertaining for me. I get to watch you be annoyed at my comments.
And face it, you wouldn't respond with you're smug pics if you weren't annoyed.
So predictable.
Any woman can make tons of money camwhoring or doing a porn vid.
Men don't have that choice.
This one is a bit of a stretch but brings up a few good points.
>>29906669
Now she's trying to make us out to be the annoyed ones.
Dear females of the world:
Stop getting useless art and woman studies degrees
>>29906710
Cute.
Keep responding, kiddie.
>>29906699
>a bit oregano
>>29906669
>So predictable
Your like a child, but please continue to feed us
>>29906491
Why is it that women don't want men to be happy? That they can't claim responsibility for indirectly causing suffering?
Lots of people think multicultralism has failed. The men of the world will once again unite to stop it
Woman be crazy yo
>>29906730
Well if you you say so.
oig
Daily reminder:
Women are allowed to get mad at double standards but men aren't.
>>29906753
>>29906748
They fell for the misogyny meme
>>29906485
>ice in an alcoholic beverage
>ever
Nigga doin' it wrong. Put that shit in the freezer or drink it room temp like a man.
>>29906569
I'd say it's the face of contentment. but keep assuming my relaxed facial expression is anything but. it seems to be your strong suit.
Last one from me.
It's a fun read though.
>>29906792
It's not women who we should get mad at, it's the men who allowed them to be treated as anything more than less than human.
We're just seeing their bitter, awful nature because we can have fun and dedicate our lives to something other than them, and they get vicious and vile, anything to get our fleeting attention. We have to seperate into homogeneous countries and keep them on leashes there, like in South America
this is how fucking dumb women are
https://www.youtube.com/watch?v=PqNgqSVTVEM
>>29906596
>the fucking fedora
kek
>>29905727
That was in the last thread. What's the point of multi-part threads if people don't check for reposts?
>>29906370
>>29906410
>>29906452
>>29906485
>>29906549
>>29906574
>>29906611
>>29906710
>>29906748
>>29906753
>>29906779
>they took the bait
I don't know why making losers angry is so funny but it is. Cya!
>>29906834
I will take what is whiskey / bourbon for $9001 Alex.
>>29906588
I'm smiling like a fiend, those endorphins feel so good, and you're just proliferating that shit XD
>>29906921
Boy you sure showed us!
Later, beef curtains.
>>29906792
>that picture
I don't think you understand what the problem is...
>>29906090
this is the one that pisses me off the most.
>>29906921
>Keep responding
>K
So mad.
>>29906921
so I have material ready for when legit shit happens. What's the problem?
>>29906727
SUCCESS KID STRIKES AGAIN
>>29906986
What's the problem then roastie? Pixelated butt making you toasty.
>>29906854
I live in South America (3rd world shithole) and it's the same fucking shit.
>>29906110
Intel HQ is right outside Portland. Literal shithole of "muh feminism and diversity"
Source: living the nightmare.
old fat women are mad that a young athlete is considered beautiful
>>29907472
>she is just an average cute girl
That's why she is so beautiful. Who is she anyways?
>>29906727
Art degrees are not that bad. My sister has a digital media degree and she gets paid very well to make advertisements.
>>29907535
I think she's a volleyball player (you can see a net in one of the pics). No idea what her name is, though.
>>29907320
Yeah but we can give you more of our nonwhites and make our societies better
dragon jeseus
>>29906485
>asexual
You mean special snowflake syndrome
>>29906699
>This one is a bit of a stretch
Not really.
>>29905451
Just 1 word and you're jailed.
>>29906699
>>29907915
these both are definetly going a little too far but a lot of what's described in them is legit.
>>29905806
Fake story in the picture, but it was fun to read.
>>29906181
>butthurt hole detected
>>29905719
>beef goblin
My sides.
>>29907915
Rape isn't exclusive to women and many men are left traumatized after being raped by a woman. It's about someone violating your intimacy, which can be extremely humiliating regardless of your gender.
Are you seriously underplaying rape that much? I mean, maybe you wouldn'T mind being forcefully fucked by some hot woman, but not everyone feels the same way as you and you are banalizing male victims as well who are already having an hard enough time being listened to in this fucked up judiciary system which completely favorise women in rape cases. Please don't be an idiot.
This is MY kind of thread.
Original roastie hating comment.
>>29906064
Even THAT is just an excuse to show off her legs
>advanced redpill achieved
You guys gotta look beyond the obvious. There's a WHOLE new layer of roastie scum to be found.
>>29906672
Web comics are literally propaganda by hateful feminists.
>>29908325
That's not the real picture, is it?
>>29906894
Jesus Christ original comment fuck
>>29907711
This is the truth god dam
Tfw
>>29908486
It probably is. And it was probably just her attention whoring. Just like 99.999% of girls on facebook or other social media.
Sexbots can't come soon enough. Let science free me from the roastie grip
>>29906107
some anon dumped a bunch of them randomly one night and then disappeared
he said that he doesnt hate women, hes just lonely
but they work for women hate thread
>>29908551
You want a sexbot waifu? Well fuck you, womyn are gonna take them away from us too.
>>29905451
the funny part is i want to study robotics and build robots to kill all the normies.
>>29907915
Remove the final paragraph, it's too obvious of a bait.
>>29906834
Look at this retarded nigger pleb.
>>29907963
His mum seemed pretty great
>>29907963
Why don't you cucks realized that western marriage laws are complete failures, and the only laws that make sense are Islamic ones? Literally 0% of the shit posted in this thread would happen in an islamic society.
>b-but men get away with rape!
False, and when you think about it, how could it possible be true? Every woman is someone's wife, or sister, or whatever, so no man has really any incentive to let rape go unpunished in the society. Everything would turn to chaos. It's just a dumb myth.
>>29908198
>It's about someone violating your intimacy
No, it's not. Rape is what women claim it is.
>>29905789
that one gets me every. single. time.
I just cant the RIIIIIIIIII
Serious question: Is it really possible for women to love men?
I mean regardless of his financial or social status and things like that.
Is it possible for a woman to go "hey, you're a really cool person, I really like you".
>>29905789
Hold on, I thought feminists and blacks were conspiring together to genocide the white man?
>>29908890
mothers usually (not always, mind) honestly love their sons I suppose
>>29908722
Again, this is not stricktly about women. Men get raped too and some have tried to declare their rape to the court and have been turned down because men who have been raped are not taken seriously by society.
By simplifying rape to fuel your narrative that rape is something that was invented by women to hold control over men, you are, at the same time, banalizing the struggle of the many men that have lived through such events that THEY themselves consider as traumatizing and, ultimately, encouraging a society that ONLY focus on woman rape, disregarding men who get raped.
And keep in mind I'm also talking about men being raped by other men, not just women and no matter how much mental gymnastics you are going to conjure in your next reply, I can almost certainly assume that you wouldn't like to be raped by some big nigger bubba and, then, be figuratively laughed at in court because our matriarcal judiciary system value women more in rape scenarios than they value men by cirtue of men being the "stronger sex".
Again, don't be a fucking idiot and realize that rape is not exclusive to women.
>>29906064
I don't get it
What is this supposed to mean?
>>29907963
This is true happened to me.
>>29908903
the racism I think is only mostly /pol/ its why I dont go there anymore
in fact I think racism is just another shitty divide and conquer strategy being used by the feminists against us men
>>29908982
Women are as sexually disinterested toward nice guys as toward chickens.
>>29909010
If they stayed at /pol/ there wouldn't be a problem, but they have to make everything about their shitty views. Their demeanor is no different from that of the people they claim to hate, sjws, tumblrfags, whatever they call them.
>this thread
i'm glad you fuckers are stuck here
>>29909010
No, it's a divide and conquer strategy used by the monetary elite of the world to prevent us from uniting which could, potentially, lead to a rebellion against the current system.
Why do people here only see through their limited woman hating scope? Women acting the way they act in modern society is, most definetly, a symptom of a bigger problem, but women as a collective aren'T the final fucking boss of planet earth for the love of God!
>>29908591
Because it would only make sense in this world.
>>29909022
No, it means that they think nice guys are chicken.
How can someone miss the point so obviously?
>>29908299
What's with the Xs? Originale comentarion
>>29909077
You mean as-in cowards? I just figured they were physically revolting.
>>29908591
There is no salvation.
>>29909091
It's a 90s thing. Xs are supposed to be "hugs" and Os are supposed to be "kisses", or the other way around, I dont remember.
It means it's a show of affection.
Now, what pieces of shit like these girls do is they do a passive aggressive thing where they say something insulting but then put a show of affection at the end. See pic related.
They're pretty much the emoji-using thots of the 90s.
>>29909094
You're getting trolled, knob head.
The chicken foot just looks creepy, like an alien animal claw thing.
>nice guys
>creepy
Do you get it now senpai?
Also, unrelated, but filename.
>>29908890
>Serious question: Is it really possible for women to love men?
Of course it is. I know we like to hate on women and I know they've been conditioned to care about social status and material objects but women aren't all the evil loveless creatures some people imagine.
>>29908198
>banalizing male victims
MRA idiot detected. Idiots like you are the reason why the MRA movement had no tangible successes in the last 100 years.
>>29909290
>but women aren't all the evil loveless creatures some people imagine.
I want to believe, anon.
I used to think that "surely, there are some pretty nice grills out there, I KNOW for a fact that, even statistically, not all of them are shitty"
But now I dont know anymore. I am yet to see a SINGLE nice grill EVER in my ENTIRE life. It's like "I believe in statistics, but fuck!"
>>29908612
Except it's not. If you as a man heard that "college is the place where rape culture exists and countless men get raped by women every day" then this would be a reason to go to college.
Pic slightly related.
>>29908974
>I can almost certainly assume that you wouldn't like to be raped by some big nigger bubba
>>29909223
This image makes me sad. God dammit. They are both shit people. Why not be nice and not retarded?
>>29909290
>women aren't all the evil loveless creatures some people imagine
They are worse. They're actively dangerous.
>>29909311
>Groups hold exclusivity and monopoly over concepts of human decency and respect and if you advocate for better human conditions and a fair system you must be part of a group and adopt a label.
Wew lad it's a good thing you're fucking retarded, otherwise I would have wasted my time engaging in a serious discussion. Keep applying those extremely stretched mental gymnastics to justify your fetish, boy.
>>29909311
This. MRA's are losers.
>>29909387
>sad
It ought to make you mad.
"Lol it's okay I'll just lose my virginity to Chad A or Chad B. I wont lose it to someone I genuinely like and have a relationship with, it'll just be one of them, who knows :PPPPP <333333 xddddd"
REEEEEEEEEEEEEEEEEEEEEEEEEE
>>29909405
>Wew lad it's a good thing you're fucking retarded, otherwise I would have wasted my time engaging in a s
Look, if you think that whining "Rape is so terrible" will help men, then YOU need to prove it.
All this agreeing with feminists about the terrors of rape has led only to one thing: Dilute the definition of rape and empower women to put men in jail within 5 seconds. Within 1 second actually.
>>29909405
>human decency
That "human decency" AKA believing cunts and considering them worthy of protection is exactly what brings down the West.
>>29909433
This simply tells me that violent revolution is the only answer. Women should not have the right to vote.
>>29909508
When empires collapse....
>>29909478
I'm not the guy you're replying to, but
>Look, if you think that whining "Rape is so terrible" will help men, then YOU need to prove it.
99% of people like forced stimulation, and forced orgasms
99% of people DONT like it not being consensual, or painful, among other things
If I was just walking on the street and a girl started blowing me I'd be like "dude what the fuck".
AND, I'm also against it because if women make a big deal about it being bad, then it should be made a big deal if MEN get raped too.
>>29909342
The genuinely nice girls I've met are very few too. Most of them are tainted by social conditioning from western society. But like you said, statistically, they can't be all bad.
>>29909401
I can get behind saying that most of them are shallow but how are they actively dangerous?
>>29909373
What, exactly, do you propose, in your shortcut arguments?
That rape doesn't exist, therefore, people sexually forcing themselves on others is not a moral offense and people are not right to demand that others don'T force themselves upon them?
I just don't understand your logic here. Because if it's that rape is used as a victim card in order to abuse a flawed judiciary system, I'm 100% on your side with that one and my point actualy argues in favor of that point because the judiciary system making it easy for women to invent instances of rape to get men into trouble is a fucking problem, but all you seem to argue about is that rape is a made up concept that doesn't fucking exist.
Then what do we call instances of someone sexually forcing themselves on other regardless of their agreement? And please, for this once, notice that I'm talking about people, not she, not her, not woman, but people, regardless of gender.
How do we treat this problem in your own idea? Because you point out a lot of problems, but offer no real solutions and it confuses me because it makes you seem like you advocate forrceful sexual intercourse. If I am wrong, please help me understand.
>>29908974
I'm with you, but you can't totally refute the idea considered in that image. It's true.
But yeah, as a rule you're right
>>29909058
roasty a toasty :^)
>>29909507
Not the guy you're replying to.
The problem is, most women arent good people, and so they'll still get behind feminism because it'll give them more benefits, regardless of how it shits on men. That means that only a very tiny percentage of women will actually be independent and say they DONT want feminism.
>>29909536
We've had a good 200ish years. But the test of time awakens man's complacency.
>>29909543
>AND, I'm also against it because if women make a big deal about it being bad, then it should be made a big deal if MEN get raped too.
Yes, if you at the same time make a big deal about men getting raped while ridiculing the idea of women getting raped, then this is something I support 100%.
>>29909555
>What, exactly, do you propose, in your shortcut arguments?
That you stop whining about raped women.
>I'm talking about people
That's your problem, right there. That's typical MRA logic. To fight feminism one must degrade women, not point out that they are people.
>>29909552
I'm the guy in your first reply.
>how are they actively dangerous?
Well, they can very easily influence other men, and other women, to be against you.
For example, if you live in a society where most men, be them chads or betas, orbit around females and blindly worship them, any female that has something against a man can just order her orbiters to absolutely destroy that man.
In a less exaggerated example:
>ew he's such a creepo, he tried to talk to me
>ayo beta, stop talking to stacy ya hear? or else im gonna beat the fuck out of you
>yeah, you tell him, chad! ill beat the fuck out of him too!
>yeah, me too!
>>29909626
Cunts will always whine.
>>29909661
>He is still dodging my question about how we should deal with forceful sexual intercourse on men.
Oh, yeah, I forgot we are in a woman hating thread.
Fuck this, I'm out.
>>29909626
Well, I'm not a fan of ridiculing women for being raped. I'm a kinky motherfucker, but even I wouldnt like to be raped when I'm minding my own business in public, so I'll extend the same courtesy to women, even if 99% of them are roasties scum, they still deserve the SAME (note: SAME, not gynocentric) protection against rape that I have.
Or, in reality, I'd have the same protection they have, but you get my point.
Why do women always scream whenever something even remotely stressful happens? When women witness a car crash or a suicide or any other similarly-stressful event in person, they scream their fucking heads off even if they're not in any danger. For example:
http://www.liveleak.com/view?i=f50_1316660330
http://www.liveleak.com/view?i=f0b_1453415163
http://www.liveleak.com/view?i=e4b_1387017951
Why do this? Why make an already-stressful event even worse with your yapping? Do they do it for attention? Are they terrified of the fact that, for two whole seconds, the people around them are focusing their attention on something other than the woman next to them, like, for instance, the guy lying splattered on the sidewalk? I just don't get it.
>>29909552
>how are they actively dangerous?
What about >>29909355 and >>29907963
Don't you understand?
What about pic is unclear to you? Women are the enemies of men and they do everything to erode what men built.
When I want to become professor and a woman gets the job just because she's a woman, that a direct threat to my life/career.
>>29909597
I wouldn't even go that far. Most people like to think of themselves as rightgeous people.
The main problem imo is the cognitive dissonance of most feminists.
They like the idea of equality yet their privileges feel very natural and right for them plus they think of their personal problems as proof that equality isn't achieved yet. This is amplified through the fact that they have no idea of what the male experience is.
Other than robots, humans are very capable and willing to live with contradictions in their thinking and are more often then not, not even aware of it.
>>29909727
>Well, I'm not a fan of ridiculing women for being raped.
Then you're part of the problem.
>they still deserve the SAME (note: SAME, not gynocentric) protection against rape that I have.
Women have a bigger protection than men.
>>29909737
Instinct.
Screaming woman -> Men's attention -> Men fix problem to get the woman to shut up
Simple
>>29909737
I'll answer you.
>women have a lower "spooked" resistance than men, which makes them yell more often
>women are not good fighters, so, like babies, their first actions is SOUND THE ALARM! WEE WOO, instead of getting ready to fight, like a man would
I guess it could be for attention, but only in very low-danger cases. I feel like in dangerous situations, the yelling is kinda justified.
And also yeah,
>women dont realize they're making the stress worse
Why do holes love talking to eachother for hours on end?
>>29909552
>how are they actively dangerous?
You can lose your job for telling the truth.
>>29909737
For attention
I think it's so ingrained they don't even notice they're doing it.
>>29909600
>We've had a good 200ish years
Approx. average life time of an empire.
>>29909831
Women need constant peer validitation for some reason, I don't know why.
They're probably really insecure is my guess
>>29908299
I think I'd rather look at geeky planets than her old used up cunt, then be forced to pay for child support once she dumps me and has Chad Thundercock's child.
>>29909761
>Most people like to think of themselves as rightgeous people.
They see "feminism is for equality" and think it's a righteous movement.
And, as much as I want to respect women, 99% of them just copy the opinions of the group, ie they have NO ability to think for themselves, which leads to group mentalities.
And, once again, the scummy women who are AWARE of this just want privileges\rights without having to do any work for them. It's definitely cognitive dissonance, but they just deny any accusations.
>>29909737
Women aren't designed to fight, men are. The screams would have either scared and animal away due to their noise level or attracted a potentially nearby male that could provide aid to the woman.
When people are scared they go back to instincts.
>>29909769
You didnt contradict anything I said.
I'm 80% sure you're baiting or are just a troll. If you dont reply with anything of worth I'll stop giving you attention.
>>29909290
>they've been conditioned to care about social status
Kek'd
>>29909895
They're not insecure, they just base their opinion on what the group thinks. They are very incapable of thinking for themselves.
>tfw debating with a female friend
>ask her to explain her point
>she tells me to wait a bit so she can google something to copy paste to explain her point
>instead of explaining it with her own words
>>29909727
They have more protection against rape than you do, retard. Until recently, men couldn't even be raped in the eyes of the law because "rape" explicitly referred to vaginal penetration. Female-on-male rape is treated as a joke, as is domestic violence. Female rape victims are immediately believed whereas male rape victims are met with skepticism. A drunk man and an equally-drunk woman having sex is literally considered rape on the man's part. You're either a blind idiot or a woman.
>>29909668
This shows that they're in a position to be evil and dangerous, not that they're ""actively dangerous""
>>29909739
>women are the enemies of men and they do everything to erode what women built
I think you're exaggerating. Women, most of them anyway, don't go out intending to ruin a man's life. They actually believe that they're at a disadvantage and that men are more ""privileged"".
They're just following their self-interest. Western society has conditioned them to be self-centred, selfish and materialistic. So women aren't inherently like that, you can't really blame them.
And let's not pretend like men are less selfish or exploitative. A lot of them are.
>>29909835
>telling the truth
what truth?
>>29909920
>You didnt contradict anything I said
>You're a troll
Wew lad
>>29910025
You fucking wot m8? That's exactly what I'm saying.
>SAME (note: SAME, not gynocentric)
Ultimately, I want the protection against rape to be equal, just like the protection against a mugging, or physical harm.
>in reality, I'd have the same protection they have
In reality, I mean MY (as a male) rape protection would approach the super high female rape protection.
You're saying something that I agree with m8, relax.
>>29909355
>That image.
>There are actually american men willing to vote shillary.
Haven't had enough rights taken from you or anything?
You fucks deserve whatever hell you create.
Lesson learned, never ever vote for a woman, or let her be in charge of anything other than an oven.
>>29910074
>what truth?
That women are inferior scientists.
>Women, most of them anyway, don't go out intending to ruin a man's life.
Nobody claimed they do. They ruin men's lives indirectly or directly.
>They're just following their self-interest.
Yes, like parasites.
>>29910074
>they're in a position to be evil and dangerous, not that they're ""actively dangerous""
Alright, lemme just put a gun to your head and put my finger on the trigger.
I'm just in a position to be dangerous, it's not like I'll pull the trigger or anything.
>>29909355
Feminism in action in our universities.
>>29905451
Thank you robots, came back here for the first time in months looking for one of these threads. I think I'm seriously going to lose it on these cunts soon. I don't want to get caught doing anything though
>be me
>be seven years ago
>be a jr in high school
>alone in hallway with two girls
>minding my own business, getting stuff from my locker
>the black one looks at me
"ANON DID YOU JUST TOUCH MY BUTT"
>wut
>both my arms were in my locker, now completely full of books and other school crap
>bitch sends complaint to the office
>I get charged for sexual assault, expelled
Bitches, not even once.
>>29907472
kek women are more critical of appearance than men if the woman is objectively better looking than her. They'll do anything they can to avoid admitting that someone other than them is attractive
I'd bet money that all those womens' boyfriends/husbands would fuck this qt volleyball player without a second thought.
>>29909835
>every error is a personal slight towards them, performed on purpose. sometimes this is true because they do sabotage each other often.
holy shit that explains SO MUCH about women
>>29910197
>Be me
>Closing store late at night, lineup outside
>Some girl is the last one I let in.
>Some other bitch demands I let her in too.
>No I say
>Omg so unfair
>Suck my dick I say
>Omg wat you say sexist
>Bitch loses it
>Calls work next day
>Arranges for me to be fired
>Fired.
Fucking cunt
>>29910515
Scientifically speaking, you're a faggot if you don't want to fuck that girl.
>>29910124
>women are inferior scientists
citation needed
>>29910133
I know I'm just arguing semantics but it's true. That would make you potentially, not actively, dangerous.
Can I point out the fact that 45% of the homicides are committed by men and that, overall, 90% of all violent offenders are male as proof for men being evil and actively dangerous? Homicide seems much more dangerous to me than "getting their orbiters to bully us"
FUCK
origneru
>>29910560
Yeah telling someone to suck your dick gets you fired. I have no sympathy. Retail sucks dick but you got to kiss ass to keep it.
>>29910560
>came past closing time expecting to be let in
>you didn't make her blow you
>still complains
I bet she said you tried to rape her.
Dumb cunt.
>>29909478
holy fucking shit I cant even hold all these REEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
>>29910515
>>29910561
I take it a step further.
I bet their boyfriends/husbands/dykeladylovers would rather have a pleasant chat with her than them (Then again, given their attitudes, a pleasant chat is more likely going to come from the asian QT).
I bet they'd rather hug her than fuck their bitch-ass wives.
Seriously bitches, when all you have is pussy, don't complain about men not noticing everything else about you. Because everything else is a fucking flaw.
>>29910617
Fair enough, it's semantics.
I see what you're saying, and you're right. Still, it's also bad that, with enough orbiter power, a woman can nuke a man. Of course there will always be something worse that happens, but it's still a bad thing.
Also, just cause why not, I'll add that men are more prone to physical violence, and women are more prone to emotional violence, which is also pretty painful, and it doesnt get registered nor is it illegal.
AND, another point, with the previous thought in mind, it's possible that women "start shit", but they're the ones who ultimately "get hit", so to speak.
Just something to consider.
>>29910110
You're right, I misread your last line. Apologies.
>>29910617
>citation needed
1. History is your citation.
2. You have the burden of proof that they are equal.
>>29907915
>implying women rapists aren't fat ugly old hambeasts that rape you abd leav you traumatized
>>29910617
>45% of the homicides are committed by men and that, overall, 90% of all violent offenders are male as proof for men being evil and actively dangerous
Because of single moms. Women's rights are the problem.
>>29910740
No, they aren't. A rapist can be for example your wife, see pic >>29909769
>>29906102
MOM I POSTED IT AGAIN
(And that's real oregano)
>>29910695
No worries mate. Props to you for being able to be mature about it.
>>29910807
If it's a copy pasta bait, just ignore it, dont give it attention.Maybe you're samefagging.
>>29910871
This is utterly true. Zyzz keeping it real as usual.
>>29910871
Friendly Reminder that Zyzz never was one of us. He had a decent body, a good face and god tier genetics which is why he had a gf even before bodbuilding.
He was based. But he wasn't one of us.
>>29910746
It's crazy how you managed to link it to single motherhood and women's rights.
Why would single mothers cause men to be more homicidal than women?
Your pic demonstrates that countries with a higher rate of homicide which should be obvious because higher poverty rates correlate with a higher rate of single motherhood and higher poverty rates lead to more crime. But it doesn't explain how most crime is committed by men.
>>29910725
I'm not disagreeing that on average, more men than women are good at science. But women who are good at science have to be as good as men to be able to pursue it so men and women working in the same field would have about the same level of competency.
>>29910690
Friendly reminder that, though women are more likely to be injured in a domestic violence altercation, they strike first more often than men.
Friendly reminder that, if police are called to a domestic violence dispute, and the woman has even a single scratch on her, they will take the man away in handcuffs even if he's lying bloody on the floor.
Friendly reminder that lesbian relationships see the highest rates of domestic violence.
>>29910690
And I agree with most of your points, anon.
>>29911067
>Why would single mothers cause men to be more homicidal than women?
Because they do. Women create criminals and suiciders. Women are truly parasitic life forms.
>>29911067
>But women who are good at science have to be as good as men to be able to pursue it
No, they don't. Thanks to gender equality laws women can be far worse than men and need to work far less, see >>29909739
Women are also protected by rape laws which they use to blackmail teachers and professors.
So it's no wonder they get similar grades despite being the inferior sex.
>>29907205
Oh god I had a fucking flashback like vietnam vets
>>29911155
Why don't the girls they raise commit as much crime as the men?
And single motherhood isn't the cause of crime, don't pretend like it is. Almost every issue, including crime, stems from material conditions
>>29908591
OK, so if all men are with their Android Waifus, who the hell would be passing the bill, and why would the SWAT raid?
If even the normies and the government are with Android Waifus, there's no men left that are cucked enough to get rid of these Waifus.
>>29906894
This looks cherry picked as fuck tho
>>29907602
There's a big difference between Arts and visual arts as a career
>>29911067
Because growing up without a father has extremely negative effects on a man? And that women raising children by themselves has become a socially-accepted and financially-viable way to live because they cried and moaned to have the opportunity until men gave in and made it happen?
Are you stupid or just joking?
I go to these threads so I don't have to feel bad about my lack of a girlfriend and a sexual life.
>>29911250
>say, 70% of men use android waifus
>say, 30% of men are against them
Simple. Or it would probably be an 80\20 rule where 20% of men get 80% of the women, and the other 20% of women would become rapists.
>>29911281
>growing up without a father has extremely negative effects on a man
No woman is capable of raising a man. No woman understands what it takes to be a man in a femcentric society.
Most of them (my own mom included) are so blind to their own privilege thanks to liberal media that they could not imagine for a second what a male actually goes through. They just point to biased statistics/myths and their own bad experiences with chads.
>>29911235
>Why don't the girls they raise commit as much crime as the men?
Because cunts hate men hence they destroy their male offspring.
>>29905451
>nerve
that's what it boils down to
i tore this random girl a new asshole via text. we made plans to meet later in the day. literally 2 hours later or something. i text her as it gets closer. no reply. same thing for the next hour. i lost my fucking mind in her inbox. here's are some samples:
>You're not Rihanna. You're not gangsta. You're a fucking douchebag.
>I tried to clean up my little shitty apartment to make it presentable . Because I want any woman who comes in my place to feel special. I knew you were fucking ratchet and that you wouldn't care if there were dust bunnies and shit. But I knew you'd also notice if it was clean. I wanted it to look nice because you were doing a nice thing for me. But fuck all that faggot shit right
>You're the problem. Not cops. Not BLM. You.
>Non-descript, idle, unfunny, asshole-for-no-reason person
>You're not cool whatsoever. We NEED police for people like you who can't even follow basic-ass social rules. "Hey. Rain check?" So difficult.
there was a bunch of other context-specific stuff too. i fucking HATE making a real connection and then they go "OOPS NEVERMIND I'M FAKE." it's like clockwork. it's not even the exception. fucking gross. women are fucking shit.
>>29911235
>Almost every issue, including crime, stems from material conditions
Yes, single moms are too inferior to earn as much money as single dads. It's unbelievable how pathetic women are. Without the government they are filth under the shoes.
>>29911391
>she shows Chad your sperging out as he's plowing her
>>29911391
Why the fuck would you show her she cares? You know that she knows she can get away with it because she can just pull some other average dude to hang out with right? Knowing you care so much about meeting her that you're sperging out about it is something positive to her. That may surprise you but it's fucking true. Acting like you don't care and just dropping her is the way to go mane.
>>29911485
>Knowing you care so much about meeting her that you're sperging out about it is something positive to her
>Acting like you don't care and just dropping her is the way to go mane.
I can confirm that this is correct. 99.9999% of women have this shitty mentality, instead of appreciating when someone puts in effort for them.
>>29907472
So a bunch of hags try to bring down a beautiful woman's self esteem to their level? Almost like men aren't the ones telling women they need to look a certain way and it's other women saying that shit.
>>29911397
I'm not sure you actually believe this. You didn't even adress the main point.
Did you just lose track of the argument? Is your perfectly logical male brain failing you?
>>29911367
This is just your fantasy. You're not even trying to form a proper argument
https://www.youtube.com/watch?v=Oih1Yf7l-c0
>>29911440
>>29911485
>>29911526
>>29911526
normally. i would agree.
but i'm a good writer. up until that point, i had only been sending basic shit. "no way, that Ghostbusters looks fucking lame." when i raped her inbox, the effect was two-fold. 1) this guy is blatantly calling me a piece of shit, 2) he's doing it really eloquently and accurately. i can almost guarantee her feelings were hurt. this is going to sound beta, but you guys are giving women too much credit for being different from guys.i've also done the same thing in real life and brought girls almost to tears
>>29906332
Your*
Thanks for the fresh pasta, fampai. Now back to rebbit with you.
>>29909661
I will go out there and say Margaret Hamilton (just saw Satellites and she came to mind) is worth a mention, but she is clearly an extreme exception.
>>29906921
Hur dur hur dur
This roastie is getting toastie indeed
>>29911604
>This is just your fantasy
No, this is proven by female behavior and by what happens after an area gets cuntified. The current Ghostbusters movie is a nice example: Whenever women have the chance, they will use it to harm men.
>You didn't even adress the main point.
Yes, I did. "Material conditions" had been an excuse why offspring of single moms performs so badly. Unfortunately the stats show that even richer single moms perform worse than poorer single dads.
Women are incompetent and inferior. Women's rights were a huge mistake.
>>29911679
1 cunt among millions doesn't disprove that pic, especially since the pic admits they women may be 2% human.
>>29906921
>i was only pretending to be retarded
originalarino
>>29911155
Could single motherhood correlate with low socio-economic status in a way single fatherhood doesn't?
t. Voice of reason
I don't know why so many other women get upset with you guys for making threads like this. If anything I just feel bad that you've been so deprived of positive female company that you honestly believe these things about all women
>>29908890
why does his shirt change in the third picture reeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee
>>29911047
>godtier genetics
>heart attack in early twenties
>>29911604
Triggered roastiecunt detected
>>29911604
How convenient that you didn't respond to my point:
>>29911281
>B-B-BUT WHY DON'T SINGLE MOTHERS RAISE VIOLENT WOMEN?
Because they know what it's like to be a woman and can raise them accordingly? Because men being raised by a single mother and growing up without a father are statistically likely to become mentally-ill, suicidal, drug-addicted, criminals, etc.? Because it's devastating for a man to grow up without a father in his life? Because the types of women who wind up becoming single mothers are more often than not absolute scum?
>>29911794
>Could single motherhood correlate with low socio-economic status in a way single fatherhood doesn't?
That has been checked and disproved. And even if it were like that, it would only mean that women are too inferior to earn much money.
>>29911737
A movie being remade with an all-female cast (because feminism is the current fad that will produce profit) harms men and proves that women hate their male offspring and want to destroy their lives? Wow, you really got me there.
The main point was that men commit more crime than women. You're trying to find a way to shoehorn your hatred for single motherhood where it doesn't fit. I thought only women used emotional arguments?
>>29911067
>Why would single mothers cause men to be more homicidal than women?
Because growing up without a father is much more severe than growing up without a parasite like women.
>>29908536
>open the door for her
are there seriously people who don't hold the door for anybody who happens to be near it that's going in at the same time as you?
>>29911622
who the fuck takes an uber to the emergency room?
>>29911756
>she is clearly an extreme exception.
whew there lad
>>29906792
blizzard is doing gods work
>>29911920
Did you miss the part where multiple people in this very thread have pointed out that single mothers are MORE LIKELY to raise men to be mentally-ill, MORE LIKELY to raise men to wind up killing themselves, MORE LIKELY to raise men to abuse drugs, and MORE LIKELY to raise men to go to prison, you stupid fucking empty-headed hole? Maybe if you stopped ignoring the facts that you personally don't like the implications of, you wouldn't be so confused.
>>29911920
>Wow, you really got me there.
No, I didn't actually, because you're just a cunt and you're incapable of understanding what I wrote.
>The main point was that men commit more crime than women
Of course they do, because of single moms and a generally misandrist society.
>>29908890
i see nothing wrong with the woman's perspective in your picture. i'm sure you'd react differently if different women did things to you.
>>29909668
>He deserves a gorgeous piece of arm candy
>Just not me, tee-hee :^)
>>29912069
>Did you miss the part
She didn't miss it. It just doesn't fit her feminist agenda.
>>29912114
>i see nothing wrong with the woman's perspective
And the picture does neither. It's actually the very statement of that picture to point out that rape is merely a construct and nothing objective.
>>29911963
Cheaper than an ambulance.
>>29911391
Why do women do this? Women and employers. Complete lack of spine or what?
>>29912158
rape should be subjective. it's kind of the definition of rape. it's sex with a woman who has made a subjective decision that she doesn't want to have sex.
>>29911921
I didn't even mention single fathers. Try again.
>>29911885
Didn't see your reply until you linked it, sorry. Can you show me the statistics showing that single mothers are more likely to raise mentally ill men, please?
Couldn't it be that men coming from poor areas have no education, are unemployed and therefore are more likely to abuse drugs, commit theft or kill themselves and single motherhood is simply correlated with poverty? Most issues stem from material conditions. Crimes are very high in developing countries. Poor countries with a very low rate of single motherhood and no significant women's rights movements. How do you explain that?
>>29912069
Why are you so hostile, anon? I thought arguments on the internet were supposed to be impersonal?
>you stupid fucking empty-headed hole?
stay triggered lmao
>>29912099
Pretty sure I did understand it. Feel free to explain what you meant though, if you want. And keep throwing around personal insults, they're convincing.
And by claiming that men commit more crime than women because of a generally misandrists society, you're blaming men's faults on society while considering women's faults inherent. At this point you're just using feminist's logic
And why do you all insist on personal attacks and identity politics? I mean, I could call you all ""virgin autistic basement dwellers"" but I understand that who you are is irrelevant to the argument.
>ctrl+f
>rape 64
>roast 33
>me and gf talking about equality
>ask why it's not my right to have a say if she wants to abort
>'my body' etc
>so if I don't have a say whether you keep the child why am i obliged to pay for a child who I do not
>mfw she says that's a good point
>>29905451
>Guy I was seeing invites me over to netflix n chill
>I bring him homemade food
>We watch his favorite film
>Cuddle
>Eat
>He doesn't touch me once even though we've already been to third base
WHERE ARE THESE DUDES THAT ONLY WANT PUSSY I FEEL LIKE WE'RE MOVING BACKWARD REEEEEEEE
>>29912590
It occurs to me, after reading this story, that killing myself might actually be something I find as a viable course of action.
I mean, if I have to live another several years being a stand-up and polite guy whom women generally feel comfortable (apparently) around but never ever ever ever ever ever are attracted to
Anyway enjoy whatever happens between you and that fucking pussy that I hate.
>>29906022
>ticket from ptown to sf
>$4500
$4k in """"""""""""""""''pocket money""""""""""""""""'
>>29912452
>At this point you're just using feminist's logic
Except that feminists are wrong.
>>29912452
>And by claiming that men commit more crime than women because of a generally misandrists society, you're blaming men's faults on society
No, we blame it on women's rights that allow parasitic entities like women to influence society.
>>29912528
Abortion equality (administrative abortion) will hopefully become reality soon.
>>29912590
Fuck off roastie.
You aint 'different', you're just an attention cunt and I guarantee that if you found a man like that, the first thing you'd do is post about how he's harassing you, online, bizatch.
>>29912841
>>29912528
This.
No rights, then no responsibilities.
Child support should be abolished. Bitches got welfare for that.
>>29912808
Just like how feminists blame their faults on the patriarchal culture and gender roles that put the violent oppressive creatures known as men in positions of power?
>>29912784
>we're both retarded and irrational but they're wrong
>>29912922
>Just like how feminists blame their faults on the patriarchal culture and gender roles that put the violent oppressive creatures known as men in positions of power?
Yes, feminists blame it on non-existing conspiracies like "patriarchy". We blame it on provable things like women's election preferences.
We also can document disadvantages of men, for example in laws, see pic, whereas feminists fantasize about "systemic oppression" that doesn't exist.
That's the difference, roastie. We argue, feminists whine and lie.
>>29912261
When you show that you like them, they like YOU less.
It's very stupid, I know.
>>29911719
I dont have a magnifying glass can you post a larger image
>>29913289
he was only pretending to be retarded
>>29912723
He told me he was suicidal at one point, and is still depressed. Likewise. Find fucked up girls with low self-esteem and no experience. Part of the reason I liked him is because he barely knew me and I have a thing for being ignored.
Biggest thing was, his politeness isn't an act, and he can joke around. The reason chicks don't like 'nice guys' is because it feels like you're trying to sell them something. It's like the inverse of the way guys fall for waitresses and stuff. Girls hate it when guys are too nice, because they can't tell if you're being genuine. If you can make her think that you're not being nice to her just because you like her (by teasing her a little) then she's more likely to warm up to you. If they feel comfortable I assume you're not creepy or ugly or smelly, you're just probably giving off an asexual vibe.
>>29912985
>we blame it on provable things like women's election preferences
US politics and the democrat/republican division are retarded and I don't like involving myself with them but 52% of democrats are women so what about the other 48%? Do you blame these men for your and their personal flaws too?
And your pic discusses India. No one actually defends India's law or claims it is fair. And if you research a bit more, you'd find out that women are also systematically oppressed there.
>feminists fantasise about systematic oppression that doesn't exist
I'm not a feminist and don't care about identity politics but whatever.
Pic related. In Saudi Arabia, women who are abused by their husbands can't even report it because they require their legal guardian (the abuser) to drive them to the police station and give her written permission to sue him. She's not allowed to press charges against him without his permission.
Women who are raped are flogged and punished for it. They're legally not allowed to leave the house alone or wear anything other than a burka.
And I know that anecdotal evidence is useless but living in a third world country I can assure you that women are at disadvantages
>>29912856
I'm not different, I was just commenting on the picture OP posted.
I was being hyperbolic, anon. But, in explicit terms, I want the guy who I thought wanted me, to be decisive. I don't want to hang out in this weird limbo between platonic friends and lovers, when we've already been physical.
Does that make more sense to you?
>>29913392
>Do you blame these men for your and their personal flaws too?
No, these are men elected in a democracy with women's suffrage. Only feminists can get elected.
>you'd find out that women are also systematically oppressed there.
No, they aren't. Men are. Women are privileged like in every society. In India women's legal privileges are extreme.
>In Saudi Arabia
Even in Saudi Arabia women are the privileged sex as proven by life expectancy and suicide rates. You see, we have hard facts, you only got fantasies.
>>29913357
I tease girls, make them laugh, ask then questions about themselves, make genuinely good jokes, and say genuinely interesting things.
I think it's because I'm Indian but I can't he sure. I've been told I'm handsome more times then I've been told or called ugly by this point in my life, but just barely.
Fyi I'm west Indian from America and I'm American as fuck, I'd only ever visit India for business, and only a place like Mumbai or new Delhi
>>29905806
how could you not kill someone after this? actually if she was bound to a chair i'd cut her fucking limbs off and put her back in the fucking chair.
>>29913476
Also
>maybe you give off an asexual vibe
This is maybe a little true I can't be sure, but I just don't ever want to be the reason a girl feels less comfortable around men.
Really, and genuinely, all I want to do to women is make them feel nice.
Also I dated a girl once for 13 months and then she dumped me because I'd love her into being close enough to a health person that she realized she had to do it for me too
>>29909668
girl on the right isnt the same girl as left and theyre still together afaik
>>29913487
i don't know. some people aren't murderers i guess.
>>29913552
I highly doubt that was her reasoning. Maybe she took issue with your inability to understand her, and felt you only wanted the object of a girlfriend and who she was didn't matter.
She clearly didn't love you, or she'd have been willing to, you know, love you.
Of course, you're in a position to know better than me but that just seems like some hardcore retarded reasoning skills.
>>29913468
Too bad having an actual conversation on this board is too much to ask for when intricate shitposters like you happen to come about.
>>29913614
add a bit of gel to that hair and you have the JUST cut
>>29913468
Suicide rates correlate with ""privilege""? Saudi Arabia has the lowest suicide rate in the world, does it mean that people living there are the most privileged? They're almost identical(0.6%:0.4%)
Does it also mean that people living in the us are more privileged than people living in Pakistan?
And did you read all the laws against women in Saudi Arabia and decide that was okay? Do you disregard the facts that don't fit within your distorted world view? Seems like all you got is a fantasy. I thought men were logical and didn't let their emotions get in the way of their arguments.
And are you so incapable of forming your own arguments that you have to rely on other men to tell you what to believe and make images that you can post in threads without having to explain anything yourself?
Who do you mean by "you", btw? Feminists? I'm not one so don't bother.
>>29913653
You didn't know this bitch
She would frequently be really mean to me and come crying to me later apologizing.
Once I told her that she made me cry and she looked at me and said, "stop hurting me" and started crying hysterically
She wanted to be alone, but she was an emotional wreck who couldn't take care of herself. She'd just moved to nyc, her house was a living room in someone's apartment with a curtain around it, and the first winter it snows her only shoes had holes in them soaking her feet.
She constantly told me that Iowa's told good for her, and that I loved in a way that she didn't necessarily deserve
>>29906792
I'd just like to point out that it was actually a man (probably a nu-male) who started the whole Tracer controversy
>>29905806
Why are women so heartless? Oregano comment.
>>29913289
Oriste, desu
>>29913719
Haha, roastie got BTFO and has no more feminist arguments left except "Y-you shitposter you".
>>29913790
>Suicide rates correlate with ""privilege""?
Yes. The more equal suicide rates are the less feminism is needed.
>>29913994
Because our society encourages them to be pampered, entitled, shallow, and materialistic.
Having a cunt apparantly entitles them to social acceptance and gives them intrinsic value, so they don't actually have any need to develop a personality or curb their impulses.
as you get older youll realize all women have to offer is their body
they have nothing else, they are uninteresting and boring, they are just pieces of meat used for reproduction
as you get older, they are more desperate, and more pathetic, and they all age like milk, and none of them are worth it.
>>29914024
That wasn't me. I replied to your argument. Not my fault you're choosing to ignore it
>>29913790
>And are you so incapable of forming your own arguments that you have to rely on other men to tell you what to believe and make images that you can post in threads without having to explain anything yourself?
There's nothing wrong in posting images that easily disprove feminist fairytales uttered by hundreds of femishits before you.
>>29913994
>Why are women so heartless?
Image explains.
>>29913852
You seem like a bit of an emotional wreck, too, since you attached yourself to her.
Out of pity, a need to nurture so your life would actually have a purpose, or a want of pussy? I'm quite curious. You've painted quite the negative picture of her. The picture of someone who needed you, rather than particularly wanted, liked, or loved you.
>>29914080
There is when you're typing one line and posting the picture as proof. It shows you're too dumb to form your own arguments and need other more intelligent men to argue for you and tell you what to believe like a drone
Also, as I said before, I'm not a feminist so don't know why you keep doing that. I don't care about idpol, started posting peacefully before you retards turned hostile
>>29914043
Keep parroting other men's ideas, anon
>>29914189
There's nothing wrong in repeating great, correct, on-point ideas.
But arguing, like you just did, against these great ideas is proof of you being just a roastie.
>>29914160
>tell you what to believe like a drone
amazing, the behavior of a group of biologically unsuccessful males called "robots."
Good luck making at least one of them self-aware. But they'll mostly just feel resentment and self-righteousness, like you.
>>29913994
Everything connects from an evolutionary psychology perspective.
Back in caveman days, women had to be ruthless in their acquisition of resources to ensure survival of progeny. Likewise, they also have to be capable of extreme rationalizations and self delusion to maintain an operable state of mind.
In those hectic days fighting for survival, the women who weren't able to leave their maimed hunter man behind because they were so emotionally attached might jeopardize the whole family. Their kids had lower survival rates thanks to their mother's genetic predisposition for romantic attachment.
The women who could freely leave him limping from the lions will likely be able to find another hunter man to gather resources for her and her child later. Women in the past were genetically wired to "love" opportunistically instead of romantically. On the other end, men had to love romantically to be able to sacrifice themselves for the family. The ones that did (that poor man in the lion's den) gave their kid's a much higher chance of survival. We were genetically selected for to be disposable.
>>29905789
That's terrible.
I hope this guy is able to find some kind of peace in his life after getting screwed this hard by an unjust system that valued an accusers word solely based on her gender alone.
>>29913552
I know a good number of really attractive Indian guys, but yeah, a lot of them seem to be quite shy/polite, even if they're westernized. I know an Indian guy who I'd totally be down for if he was interested, but he seems quite self-conscious.
If you like white women, maybe you'd have more luck in the UK, or Australia. Have some Priyanka Chopra looking babies with a cute accent.
>>29914227
>arguing against an idea is proof of you being a roastie
roastie is a meaningless term so I don't really understand what you're trying to say
>>29914326
>roastie is a meaningless term
haha, roastie newfag confirmed.
>>29908299
>>29909900
atcactggtactccagtcttgtagagggatcactattcccagattcgctataacacchta
>>29906834
>Not relishing the differing taste/consistency of the cocktail as it melts.
You are bad.
>>29914354
>I said it again mom! Am I cool yet?
I understand what it's supposed to mean, retard, but it's still a meaningless buzzword. The superior gender, indeed
>>29905906
What the fuck.
How do you betray the father of your children like this, and not feel anything?
>>29906847
it's even better reading this in a kind ale war's voice
>>29914326
>roastie is a meaningless term
No, it isn't. It dehumanizes females. Something that the whole society should strive toward.
>>29908982
Nice guys are viewed as weak and undesirable. (Hence the scrawny chicken leg)
>>29914555
Nice digits. And why am I stuck arguing with the least intelligent guy in the whole thread? Literally bottom of the barrel
And did you get that from another post on r9k or pol? At least you bothered to type it out yourself this tine. Good boy
>>29914416
I can actually see her side of it
Think of the amount of personal and intellectual growth she must have went through to turn her life around like that, she is essentially a completely new person
If the guy she married had not similarly grown over that time then I can understand their bond being eroded
>>29914624
>And why am I stuck arguing
Because you're just a roastie.
>>29909058
herohero tom?
>>29914663
You said it again, wow! Did you teach your high school friends all these dank memes?
Also,
>stock photo from google with low-effort shitty captions, made using ms word
>>29909223
this tears me up.... fuck the orbiter but the girl basically getting her choosing of who will fuck her brains out for the first time.... they probably had a mini orgy
I tried for years in high school to put on a face and nobody would ever think of me sexually
JUST
>>29914746
>stock photo from google with low-effort shitty captions, made using ms word
Haha, you are so triggered, the only thing you have left is to bitch about ms word and stock photography (after you bitched about /pol/ macros and /r9k/ memes).
You have literally nothing left, roastie.
>>29914663
Stop being a colossal faggot and put forth a proper argument/discussion point for her.
You're pretty much vindicating her, you're not antagonizing her with retarded memes.
>>29908325
Looks like one of my Muay Thai assistant coaches, almost to a tee.
In fact, I'm pretty sure that is her.
If so, then the reason she doesn't have a boyfriend is probably because she likes to snap angrily at people for no provocation what so ever to put them down and will kick the shit out of anybody that gets paired up with her in the ring to assert dominance.
Funny how she acts the complete opposite on plebbit. Whatever it takes to get them upboats, eh?
All the time, these women hate threads ask for new content.
If there's not enough content of trashy women then maybe women aren't too bad after all :^)
>>29906834
One of the worst things stupid people can ever do is try to give advice.
>>29906672
The stupidest thing is no man would ever feel uncomfortable by that portrayal of Batman. They would just realise they don't like it and move on to something else.
>>29914787
Sameroastie, leave.
>>29914877
>If there's not enough content of trashy women
There's more than enough content. But due to the robot limitation (you need top post original text) this is rather a /b/ tier type of thread.
>>29914945
Not me, retard. Done talking to you anyway, you keep reposting the same memes that I've heard a thousand times before
>>29914928
what are you talking about? that batman makes me very uncomfortable. i showed my friends and they all punched me. i showed my dad and he cried in his room for a week. i did show my gay uncle as a test and it didn't bother him at all. maybe you're gay?
>>29914945
Based on what, exactly? Did you check?
>>29914996
>I've heard a thousand times before
So why are you still here, roastie.
why hate women, im sure there a lot of vapid evil whores but there are some normal good ones too.
>>29914645
Being a relativist doesn't change the fact that she basically threw him away like garbage for the sake of "personal development".
That's essentially what a sociopath would say.
>>29915078
Probably because not all men are retarded groupthinkers.
>>29914263
Boy, the way evolution works sure does sound retarded
>>29915097
a sociopath would expect her to stick around to be some fat faggot's doll just because he wants her to.
>>29915085
>there are some normal good ones too
Please report back.
>>29915085
But only after you've been ruined.
>>29906485
what game is that
originalalalalalalaaladhdhbehche
>>29915167
That anon's got no real argument. The fact that he he made an acronym doesn't make it any less an emotion-driven opinion.
You may think you hate women, but if it turns out you don't hate all of them, then you need to refine your category or else you're saying some vague, flimsy, imprecise, lazy bullshit.
You can't just say: I hate women except for the good ones, unless you're okay with having the mindset of an underdeveloped child.
>>29915085
This. Hating the stupidity and atrociousness of humanity and society as a whole is actually far more reasonable than directing that hatred on a single group, whether it be gender, race, age, etc., since anybody can contribute to it in one way or another.
People spend their entire lives asking themselves why such humans exist and what can be done about that, so bitching about it on a Lithuanian berry-picking forum seems futile.
>>29915279
exactly, i dont understand these threads desu
>>29915085
>i'm sure black mambas are some of the world's most aggressive and dangerous snakes, but there are some non aggressive ones too
No one in the right mind would wander into a black mamba habitat thinking this. And with how much feminism has distorted the modern women with privilege, they are even more dangerous than venomous snakes.
>>29915267
>You may think you hate women
We don't hate women.
>>29915297
they're "waah nobody touchee my pee pee" threads. why else group all women together unless all women aren't fucking you?
>>29915339
>they're "waah nobody touchee my pee pee" threads.
That's a valid reason to hate women.
>>29910629
Does squatting make you have a bubble butt or something?
My ass looks fine without squatting
>>29915339
>why else group all women together
For the same reason you group dogs together if you talk about dogs.
>>29914150
It has a lot to do with how we met.
It's too much to post. If you have any real interest email me my throwaway email is [email protected]
If not, nice talking to you.
>>29915328
Correction: YOU don't hate women. The misogynists here do.
Therefore I'm not talking to you and I figure that would be very obvious, since you literally identified yourself as not being my audience. But yes, I'm glad you have recognized the actual "problem" you have, though I don't seem to be in a "legal privilege hate" thread.
>>29911952
>open door
>mother always walks right through and doesn't hold it
Like clockwork
I wish she was dead
>>29915326
>filename
Did you learn the word "counterweight" from the title of the Bestgore page you hastily downloaded this from?
Summer is here.
>>29915426
>Correction: YOU don't hate women. The misogynists here do.
Circular logic.
> I'm glad you have recognized the actual "problem" you have
Any more delusions of yours you want to share?
>>29915497
I apparently had to spell it out for you, since you didn't realize other people have different opinions from yours and have explicitly stated that they hate women. It's tautology, btw.
I don't know what you mean by "any more delusions." Which delusion have I shared, especially in what you quoted?
>>29914777
Digits confirm, roastie BTFO. KEK has spoken
>>29915565
If a girl ever tells me this I hope I have the stones to be mean to her. Because that's a fucking mean ass thing to say
>even with his inadequacies, you're adequacies are not enough
That'd fucking suck to hear.
>>29915141
The concept of faithfulness seems to allude you.
Not to mention the sake of keeping the family intact. All it's done is set a bad precedent for her kids.
>>29906090
Eh, I'm not sure where this is, but in my country he would get priority child custody and alimony because he was a stay at home parent.
>>29915426
Dat post. Dat stupid.
>>29915399
B-but anon, women are better than dogs.
>>29915666
Misogyny is a meme for retards. Anyone who buys into the idea that hating billions of people, many of whom they've never met nor heard of, indiscriminately, is clearly simple.
Like they couldn't narrow down their categorization with even a single descriptor? "I hate women who are entitled, slutty, and retarded." Boom. An actually accurate sentiment. Though I'd broaden it to: "I hate people who are entitled, slutty, and retarded."
That is, unless you acknowledge that your belief is emotion-fueled and has nothing to do with logic.
Most of the women I see at my job as employees and customers are very fat. I'm not gonna judge or anything but why do so many guys have to get all Abercrombie physique when I see so many fat girls? You know that's the motivation for guys to get into shape.
>>29915666
Satanic trips confirm.
Roastie BTFO
>>29906090
Jesus fucking christ!
The article is much worse than this screenshot.
http://www.dailymail.co.uk/femail/article-467390/Househusband-backlash-high-flying-wives-ditch-men-em-em-wanted-stay-home.html
She took the kids *and* managed to get 'maintenance' payments from him.
This article has tipped me over the edge.
I literally just now have started to genuinely resent women.
I'm all for equality, but it seems that men are the only people making concessions.
>it's another 'r9k' gets angry at women instead of just sorting his shit together episode
kek
>>29915981
Except this shot totally affects me
>>29916012
Cool, if you've been falsely accused of rape or had a high paying job go to a woman instead of you because of diversity you have my sympathy. Seriously, you do.
But most people on r9k complaining about this shit won't have ever been affected.
>>29915760
>Anyone who buys into the idea that hating billions of people, many of whom they've never met nor heard of, indiscriminately, is clearly simple.
Anyone who buys into the idea that hating billions of life threatening bacteria many of whom they've never met nor heard of, indiscriminately, is clearly simple.
>>29915760
>Though I'd broaden it to: "I hate people who are entitled, slutty, and retarded
Sure you'd broaden it that way, because you're just a roastie. Roasties hate it to be demasked.
>>29915760
>Though I'd broaden it to: "I hate people who are entitled, slutty, and retarded."
That would be off topic. Fuck off to tumblr, cunt, and start your own threads instead of spamming this thread with your pro cunt bullshit.
>>29916035
Not even a part of this argument, but
>most people on r9k complaining about this shit won't have ever been affected.
I've never been stabbed, but I was still bothered when I heard about a guy I knew from high school getting shanked in Memphis.
You don't have to be an immediate victim of a phenomena to have an opinion on it, and there is quite a good deal of material on how men are getting fucked over in the legal system in regards to false rape claims.
>>29907472
Why the fuck are they doing this? What do they think this is going to accomplish? Is bringing down the self-esteem level of this girl, let alone any girl, really worth it? These whores sicken me. To bring someone down because of 'poor genetics' sickens me. No one should be treated this way
>>29916289
And she looks like a qt to me. She's very beautiful, in fact
>>29906090
Bitches had it coming.
>>29911963
mexican welfare parasites
>>29916272
>I've never been stabbed, but I was still bothered when I heard about a guy I knew from high school getting shanked in Memphis.
Again, agreed. But there's a big difference between getting annoyed about/disliking something and devoting hours of your life getting angry about it.
Like if I heard someone got stabbed in another country for no reason I'd be annoyed, but I wouldn't make 200 infographs about knife crime and shitup r9k constantly lol
>>29916272
>and there is quite a good deal of material on how men are getting fucked over in the legal system in regards to false rape claims.
>>29916345
Ooops, wrong pic. Sorry, /r9k/
>>29915483
did you just learn that there is more than one country on the face of this planet?
summer is truly here
>>29913767
There's more to it than just gel. JUST is a lifestyle.
>>29915981
I AM SILLY
holy fuck i hate this stupid originality requirement so much
>>29906485
what game anon TELL ME WHAT GAME PLEASE !!! i want it right now
>>29908890
I think in most cases a mother loves their child more than even herself. Same goes with the love of a man towards a woman
You guys need to cheer up! Women like you if youre nice to them.
>>29905451
Juicy, fresh slice off the ol' roast
Best regards from Portland Oregon
>>29908890
>Is it really possible for women to love men?
No, men love women. Women only love that men love them.
>>29916345
Reminder: Childless hags are 3x more likely to develop breast cancer than young mothers (20 and younger)
>>29906792
I don't want to be THAT guy, but it was a father/man who made the forumpost back then,
saying "it doesn't fit her personality, it's completely okay for widowmaker to pose like that, it fits her, my daughter really likes her mimimi"
Blizzard agreed and changed it, while the "Tumblr-Femnazis" were the ones criticising the change, saying:
"She OWNS her sexuality, why would you censor her pose, why is it wrong for her to pose like that"
At the end it was a hand full of people that complaied in the Forums
and hell broke lose, way too much drama in my opinion.
>>29909223
>2 girl, 2 boys
>like a double date
>"i'm gonna lose my virginity to jake or bryan tonight"
They've both decided these Chads will get to fuck them tonight but they don't even care which one? They're just going to make up their mind who they will each fuck that night?
This is why very few women are great artists. They have no passion for anything. Guys will write poems about the creases on a girls knees but they honestly just don't care.
God, I hate women.
>>29916930
Is this a woman? This looks like a man.
>>29907472
This is something that always grinded my gears,
women were mad at men for being "misogynistic online" but when you go on Instagram/Facebook/any similar Website on any cute/pretty/skinny girls profile and check the comments on the photos, it's most of the time other women putting them down, especially when they are uglier themselves.
"She looks anorexic"
"You guys keep complimenting her, if you knew how much make up she has on"
"Pretty? She should eat a burger that doesnt look healthy anymore"
"Thats not how natural boobs/nose/whatever look, she sure had a op"
"She clearly photoshopped everything, you can't be this skinny"
"She only has such a nice ass because of her genetics" (not because she is squatting and actually doing something for her body)
>>29905906
She did it to be a role model for her kids
She would have been a better role model as faithful and obese than hot and a bitch
>>29909737
I remember reading some blog post fromsome woman who wwitnessed a man who jumped in front of the Toronto subway. 1% of the post was about the guy who jumped, the other 6 paragraphs were here saying how she got serious PTSD from the event, and how "hard" it is for her.
She also complained how she called a suicide hotline, not because she was suicidal, but because she wanted therapy for witnessing the event. She acted surprised when they told her to fuck off, as she was holding the line for people who were actually dying.
Even when life fades from others, women still need to find a way to make it about themselves.
>>29907535
>>29907605
Sabina Altynbekova, her Instagram:
https://www.instagram.com/altynbekova_20/?hl=de
Is 19 years old, 1,82m tall and weights 59kg.
AND she is not just a random girl playing Volleyball, she is playing in the National Volleyball Team of Kazachstan.
No wonder the old hags are mad.
>>29917343
>1,82m tall and weights 59kg.
What is this in American?
>>29906485
wat game is that
>>29907963
Similar stuff has happened to me, in Finland though and not UK
>>29909223
kek
this is how school shooters are born
>>29915249
>>29916663
>>29917470
Isn't it just GTA V?
>>29917398
about 5'10 tall and weights 130pounds
>>29917566
i dont recognize the car, the environment and the hud
>>29917566
>>29917591
nope
maybe modded watchdogs?
I dont recognize the houses, the hud, map and cellphone are unknown and the car is definately modded in since its a real life car.
Anyone know what game this is?
>>29906485
>>29906485
>>29906485
>>29906485
>>29906485
>>29906485
>>29915249
>>29916663
>>29917470
>>29917566
Wrong. Its The Crew, very comfy game.
>>29917398
6ft and 130lbs I'm pretty sure. not getting out the calculator though so that's the best I can do
>>29917559
It's probably more frequent than thought. Cunts are dangerous.
>>29916035
>Seriously, you do.
No, he doesn't.
>>29917644
ah yeah that makes sense
so its racing only
does the crew have a singleplayer crack yet?
>>29915735
At least dogs are sweet, loyal and will fight for you until the bitter end, something roasties are clearly not.
>>29908536
>thinking that liking star trek makes you a nerd.
It's literally the most mainstream sci-fi series aside from (maybe) star trek.
>>29917935
*aside from STAR WARS.
fuck
>>29910871
Seeing this posted years ago made me start lifting just so I could make women feel the same way they've always made me feel. I realized that even if i made them feel like shit for that one moment, an hour later some guy was probably telling her how beautiful she is and she gave up the pussy. I don't think there's any winning to this game. Women aren't smart enough to see how shit they are and there's always a man who gets a whiff of that pussy and will tell her whatever she wants to hear to reinforce how she sees herself.
>>29914293
He now works for the NFL actually.
>>29917883
Yeah, you cant get out of the car or something, but when i play it i basically never race, just cruise around.
Dont know if there are cracks available or not, ive got it on steam.
>>29906792
Please don't take away Snake's booty
>>29911622
Fella's got a /v/-tier rage problem. It's fine to call her an asshole if she's being one, but that's the kind of emotional response that females feed on. Should've just called police and waited.
>>29906894
>Name 3 Allied powers
"US, Germany -"
I love the interviewer's expression when she said that, and his smile hiding technique.
>>29911235
Grew up from a well off single mom. It just doesn't work. She wont teach you jackshit about life cause she lived on easymode and then she'll wear you down with critique and drama.
great thread
why are women allowed to live?
>tfw ugly af so don't have to deal with women's bullshit
feels great desu famalam
In 45 B.C., New Year's Day is celebrated on January 1 for the first time in history as the Julian calendar takes effect.
On a march, especially in the campaigning seasons, it would be a very busy life. Legions were able to construct entire pallisaded camps with trenches around the outside and stakes, in just a few hours. Several thousand men would be put to digging trenches, others to building the pallisades, others to setting up all the tents. There would also be many sentry duties throughout the night. On a typical marching day they could cover 30kms in 5 hours depending on the terrain.
Generally, food was provided in camp but small groups of soldiers would usually cook their own food, usually stews, soups, and bread that would be provided by the bakers. Whenever possible they would hunt for deer or rabbit or whatever game they could, to get some extra meat into their diet.
Mid-February was Lupercalia (Wolf Festival) time. Celebrated on Feb. 15 at the foot of the Palatine Hill beside the cave where, according to tradition, the she-wolf had suckled Romulus and Remus, the festival was essentially a purification and fertility rite.
Directed by the Luperci, or "brothers of the wolf," the festival began with the sacrifice of two male goats and a dog, their blood smeared on the faces of Luperci initiates and then wiped off with wool dipped in milk.As thongs were cut from the sacrificed goats, the initiates would run around in the streets flagellating women to promote fertility.
After a long siege(around three years), Odoacer, the man who deposed the last Western Roman Emperor, was forced to surrender the city of Ravenna to Theodoric's army, sent by the Eastern Roman Emperor Zeno.
To seal the piece, Theodoric invite Odoacer to a dinner at the "Ad Laurentum" palace(now destroyed). During the banquet, Theodoric drew his sword and stabbed him in the collarbone, directly piercing Odoacer's heart; then it's said that the King of the Ostroghots exclaimed "This guy surely had no bones".
![FireShot Screen Capture #068 - 'Me [30 M] with my wife_' - www_reddit_com_r_relationships_comments_49pzbj_me_30_m_with_my_wife_30_f_10_years_she_had_a.jpg](https://i.imgur.com/jJP8doV.jpg "FireShot Screen Capture #068 - 'Me [30 M] with my wife ' - www reddit com r relationships comments 49pzbj me 30 m with my wife 30 f 10 years she had a")
The plauge was caused by the fleas found on animals and people. It is most commonly associated with rats since that is how the disease traveled so fast. Rats would get onto ships which would move all about europe.
Contributing factors that I think made things worse.
Cats were considered to be from the devil. The lack of cats lead to a very large rodent population.
Bathing was also considered evil, so it lead to prime conditions for fleas to produce and infect.
Cities were just beginning for form so large parts of the population were living in close together. It lead to easy transmition of disease.
Black Death affected everyone...even the royal line even though they tried to deny it. It killed diplomatic relations, marraiges, and lives. Even including the death of the archbishop. An old child's nursery rhyme:
Ring around the rosies
Pocket full of posies
Ashes, Ashes,
we all fall down
In medieval times, a woman could get an annulment if her husband was proved to be impotent. in 'Medieval Lives' Terry Jones writes:
If the man failed to perform in the marriage bed, the wife was perfectly at liberty to go public about it. A twelfth-century manual advocates a physical examination of the man's genitals by 'wise matrons' who - presumably - knew how these things worked. Witnesses were then summoned to observe a full-blown road test of the under-performing member:
A man and a woman are to be placed together in one bed and wise women are to be summoned around the bed for many nights. And if the man's member is always found useless and as if dead, the couple are well able to be seperated.
Prince Leopold, youngest son of Queen Victoria, "attended the college of Christ Church from 1872 to 1875. He fell hopelessly in love with the Dean's daughter, Alice Liddell, a vivacious and pretty teenager. She had provided the inspiration for Alice in Wonderland created by the Revd. Charles Dodgson (Lewis Carrol) who was a mathematics tutor at Christ Church, as well as being a perpetual curate. A liaison between Prince Leopold and Alice was forbidden by Queen Victoria on the grounds that, as a mere commoner, Alice was unsuitable as a marriage prospect for a prince of the realm.
"Prince Leopold, a haemophiliac, was married off to a German princess, but he sadly died at the age of 30. Alice went on to marry another Christ Church student, Reginald Hargreaves. Interestingly Alice named her son Leopold and Prince Leopold named his daughter Alice
>>29915141
so a sociopath would expect someone who unconditionally loved and stood by a lardass fat fuck doesnt deserve to be thrown away like a piece of gum that doesnt have the flavor anymore?
are you a woman? i bet youre a woman.
>>29916345
>UK
>Women aren't having children
>flood of "refugees" from all over the world
Was Children of Men a prophecy for the future?
>>29918917
If you cant procreate, whats the point of a relationship? Times where better...maybe not tech or health wise. But at least bitches were treated as such, behind the curtain of course.
>>29911047
You don't end up hating women like Zyzz without being one of us. He might be more attractive than others in our boat, but he could have also been playing in a larger pond with more competition where being not a mutant doesn't cut it.
http://www.bbc.co.uk/news/uk-england-nottinghamshire-36775398
>Get paid a work more because you do more shit than a woman? That's a hate crime
>Out for a walk and say good morning to a woman in passing? That's a hate crime
>Holding a door open for the woman behind you so it doesn't smash into her face? That's a hate crime
>>29906006
>tfw tall
>tfw will NEVER give kids to a short woman
I implore every other tall man to do the same. Let the manlet gene die out. Any woman shorter than 5'8" is trash.
>>29908903
>every time a conspiracy happens the common people are in on it, not just simply useful idiots
>one case of a conflict between women and black men means that neither groups could possibly still benefit from the same thing which is making the white man responsible for all the bad things in the world
Such logic.
Textless posts are not allowed.
You have been muted for 2 seconds, because your comment was not original.
the origin null post is origin
>>29907839
Are people jealous of asexual people?
It's a serious disorder that people haveand it's pretty much the best way to live life.
>>29915011
>i showed my dad and he cried in his room for a week
I get the joke and imagining that made me laugh pretty hard.
>>29906847
Drunken fucking wisdom.
>>29911270
Literally every single one of these kinds of videos is cherrypicked.
Believing in them is like believing Youtube prank video are real.
>>29911320
>>29911250
>>29908591
>Be me at work, having to stay late one day (work is now enforced ever since the great employment drop of 20**)
>An older woman, let's call her Janet is one of the few people left in the building
>She brings me coffee today
>Don't want to lead her on since I'm happily married to my android, Emily, but accept because I don't want to seem rude.
>Wake up in a dark room, restrained with my head woozy
>Blindfolded but I know it's Janet that has done this to me
>Cry as she violently rides my dick
>I have minor phimosis that my wife has been helping me with.
>This, combined with a lack of lubricant, causes my foreskin to split.
>I've never broken a bone or anything, so I can't say I've experienced alot of pain in my life but nothing has ever hurt more than that.
>Janet lets me go, sure that my shame will keep me from telling anyone.
>Finally get home to Emily, horrified by what she might think of me (she was programmed for ultra-chastity and loyalty, we didn't do anything sexual before we got married)
>Inb4 "Just wipe the history" Her time around me has made her a real person, better than your shitty robosluts who change out personalities like clothes
>Immediately notice my change in behaviour and my lateness, I try to play it off with excuses
>She insists that we make love
>"What happened to your foreskin?"
>I break and tell her everything inbetween sobs
>We go to hospital and tell the police
Thanks to the new laws put in place after the increase in female on male rape, Janet is put behind bars. That's my story r9k, remember there is no shame in coming out about rape.
>>29919314
Please someone reply to this, give me pointers I don't think it was very good. But it took me like 30min to write. At the very least someone tell me it was shit.
>>29915085
No there aren't. Sweet ones, masculine ones, smart ones, etc. That girl you think is different..all of them worship Chad dick. They may claim not to just to spare your feelings, but this is only an act of foresight for when they need the betabux.
Is it weird that the only time I felt positive emotions toward a woman was watching a gif where a lady and a man(most likely a couple) suddenly got jumped by a bunch of black dudes who got on the guy and randomly started beating him down and instead of running she spent the entire time hitting and trying to pry them off physically?
That woman must've had some inverted testicles or something.
>>29919468
>That woman must've had some inverted testicles or something.
I'm not sure that this is true. Women on some level know that they're far less likely to be the subject of violence. I don't think women even really fear violence much at all. Just look at any war, most victims by far are men. The first to be lined up and shot are always men. Women didn't have much to fear at all during war except aerial bombing, and even then they probably got preference in shelters and evacuations.
>>29919567
She got elbowed and still tried to help him IIRC.
>>29919599
I think I've seen the video you're talking about, it's not a huge self-sacrifice and it's pretty meaningless when there's never been a time in human history where women have been conscripted into war like men have been - and yet all women claim that women were somehow the victims of men.
Even when an attack is ongoing, even when a guy hits a woman back, in general most women have an idea they're not the main target and won't be hurt as much.
>>29905451
Most people on this board don't have education, ambition, or a job, AND don't have a pussy, so there's that.
>>29905719
TIME TO TIP THE SCALES!
>>29919314
This was very good anon, and might come true one daybut don't count on it
>>29919644
Maybe so but I have 0 reason to believe most women would even do what she did even if they aren't the main target.
>>29919709
>>29919314
I forgot to add a smug remark
about Janet getting fingerblasted by sheboons in prison
>>29919314
I really enjoyed your story, I'd definitely read a full fledged short story like this.
>>29906779
well hey there TJ "Henry" Yoshi
>>29919878
I'd tell you why women are terrible but first we need to talk about parallel universes
>>29915981
>as long as it has no impact on MY life
Other people have been screwed over by the system that gives privileges to women and finds it acceptable that they ask for more through movements like feminism ? Fuck them !
Empathy ? Never heard of it, starts to look like the picture was made, in fact, by a woman.
>women have life on easy mode
Objectively true for the majority of them because of their privileges.
>where we can't be the superior gender
Ha hahahahahahahahah
Strawman. It's confirmed, this image is made by a feminist, the whole point of it is to tell people not to bother with them and let the feminists gain more ground.
>has to create an image where a comical caricature of a person with exaggerated behavior argues against feminism in order to make a point
>the point is that not acting against cancerous movements that clearly impact other people's lives negatively is a good thing
Amazing
>>29919400
Probably not getting replies because it's too optimistic for a women hate thread.It's pretty good
>>29916345
Fucking beautiful
Just wonderful
>>29907915
Orgasms are entirely based on stimulus, it has nothing to do with your pleasure, you fucking mong.
>Orgasms are entirely based on stimulus
I don't have an anime girl smug enough, are you serious?
>>29906158
Not when it's paying for them. Honestly, most of the girls I know love getting free stuff from guys. Actually some of them judge it hard when the guy doesn't offer to pay for her drinks / food on a date.
They don't really like stuff like holding doors, lending jacket when it's cold etc. though. Too proud for that I guess, but the pride doesn't work when it's about money.
>>29918934
>Bachelor/bachellorette parties
>literally be as degenerate as possible even though you're in a relationship parties
Can anyone explain to me why these are a fucking thing?
>>29912528
The point is retarded.
You father a child, you pay for it. Why should the rest of society be cucked into taking care of your hellspawn.
The woman is completely right in saying its her body and her decision, since you cant abort a fetus without harming her in the process.
Whats the big deal anyway, child support is dirt cheap.
>>29911235
Girls don't need to commit crimes to make a living. Even the ugliest girl can some guy to support them.
Guys aren't coddled, and the desperate ones living in destitute conditions will break the law to gain resources.
>>29920928
Its like paying the rent of an item that you neither see nor get to enjoy any use or personal gain from
Now rent a lot of unuseable tools and you will certainly get fucked
Also most countries scales it on the income of the farther more income higher price, you just happen to be poor socialist/ liberatarian scumbag with shitpay
Get cucked
>>29907472
>have some female friends
>when I get a date, I sometimes mention it and they ask to show them a picture etc. and they just criticize these girls the most of the time even if they're more attractive than them
>actually some of them criticize everything I mention about those girls
Well, it's only the single/younger ones who do that though. I think it may be because even though they wouldn't want me themselves (most likely), they don't want me to look at someone else than them either.
>>29920994
Its not at all like that. First of all you have to be pretty dumb or unlucky to father an unwanted child, secondly men have nothing to lose from an abortion, while women have the immedeate trauma from the abortion and long term effects, making it harder for her to become pregnant in the future.
Its really more like buying an item, then realizing you dont like it and then being mad for having to pay for disposal fees(child support).
>>29914645
>If the guy she married had not similarly grown over that time
Of course he wouldn't grow over that time, he's spent most of his time supporting her through her transformation, so why can't she return the favor? Do us a favour and kill yourself, roastie.
>>29921113
>implying condoms dont break
>implying child support isnt an incentive for poor women to either lie about child support, or poke holes in condoms in order to trap some poor either drunk or sober sap into supplying her with a steady stream of money
>implying women always have the best of intentions
Also angry rostie detected
>>29921221
>fucking someone with a cheap condom, also fucking someone when they arent wet
>fucking poor people
>fucking evil bitches
Literally all these problems dissapear when youre not fucking strangers, paupers or crazies. Child support laws are literally made for chumps like you because you dont understand what consequences are.
>>29921221
Ie. Its like the saleswoman telling you that the rake can cut paper, then even before you manage to unpack it you find that it cant cut paper you however you can return it but you still have to pay for it everyday from then. On top of this the saleswoman can take it from you and you still have to pay
>>29921253
>implying the crazy shows upon first meeting
>implying that you not knowing the secret intentions of the person makes it your burden to carry
Nice victimblaming roastie
>>29919929
desu didnt read all that but ill just assume you're mad about the comic
which is kind of fitting because it's literally saying "dont get mad and put so much effort into something so trivial"
so you nicely proved my point lol
>>29921321
If youve been the victim of a crime call the cops...
also:
>fucking people you just met
>>29921406
>asserting you cannot be a victim unless it was a crime
>implying it doesnt amount to fraud
>implying people you have known for a long time will never try to fuck you over if they themselves got a reason or incentive to do so
No man is safe with these types of laws
>>29921515
If you had your way society would have a greater burden, women would be less safe, and the streets would be full of fatherless children.
Just so a few men can safe a couple of hundred bucks every month for a few years.
Good luck ever convincing people to vote for something like this.
>>29921635
>streets would be full of fatherless children
You do know that 50%+ of children with mothers under 30 years old are born to out of wedlock parents, right? In the majority of these cases, they'll end up being raised by a single parent.
>>29921674
>the situation is already bad
>lets make it way worse
>>29921635
Imagine the decrease in out of wedlock born children when the mothers realize they can no longer profit from this arrangement
Its almost as if someone swept away the economical incitement.
>roastie btfo
>>29915760
t. Lolcow user ''raiding'' 4chan again xD
>>29921710
>>29921739
Ie. Making a bad situation better
>>29921710
You're ignoring the incentivizing aspect of all this free money.
The state is literally becoming the 'alpha provider', pushing men's provisioning power out. Feminists of the first wave who called for "matriarchy" specifically said they wanted to get rid of men's ability to provide for women, to make those men redundant.
This pushes men into a sexual position as beggars, where THEY in turn become less responsible too. They have more reason to sleep around rather than be sexually responsible, because what do they get for responsibility anyway??
Perfect example is that thing they had where single mothers were provided with priority housing - we know that many many families broke up as a result of families deciding to pretend the father was no longer around, so they could get access to these homes. Then gradually the fathers did end up getting pushed out.
If you're so full of charity - give the money directly to the surplus males created by single-mothers directly. But that goes against matriarchy doesn't it?
>>29921766
>>29921739
They would still get paid, just not out of the fathers pocket.
Also the main point still stands:
>sex results in an unexpected pregnancy
>men can decide if they stay or leave
>no consequences whatsoever
>woman either have to decide between a life altering procedure or living as a single mother, effectively removing themselves from the dating pool, professional life, making her depend on welfare
>all so that a few guys can stick their unprotected dicks into the first wet hile available to them
>to add to that the man can still change his mind at any point and try to get in touch with his kid, while an abortion on the womans side is final
The free money arguement is also pretty worthless because child support is still cheaper than raising a child.
https://www.youtube.com/watch?v=QPsn17_a8-g
>>29921935
Thats satire, you dip.
>>29921914
No kidding. A woman spends all her time and money raising a kid on her own, and virgin men still complain that other men have to pay child support? I wish I could get out of all my responsibilities by paying a bit.
>>29921914
>sex results in an unexpected pregnancy
But in what context does sex take place? In a context where women are assured of subsidisation, they - the ones with the most power to control reproduction - now have a significantly reduced incentive to be cautious in who they have sex with. They have cut men's MORAL qualities out of the equation, because a man's ability to earn and provide, his willingness to do so - are qualities which she no longer has use for. Men being reduced to fuckboys now chase pussy without regard for anything (go watch Spike Lee's film "She's Gotta Have It", where one woman has the option of 4 men - she sleeps around and hurts the feelings of the one guy who'd make a stable partner... finally after he threatens to leave she decides to stay with him...but this doesn't last because "she's got to have it" (sex), so she goes to bed alone, and he's left to probably become a predatory alpha or die alone.
>men can decide if they stay or leave
Men are expected to stay no matter what, and who pays for it when it's subsidised?? Primarily men, but they're not paying COLLECTIVELY in a sort of ant-colony situation. Their moral power over their own money has been taken away, and they've been left with nothing but PUA articles and sexual objectification by women who have no interest in anything but looks and charm.
You see what you're doing is getting roles mixed up. Men are only sexual pursuers en masse BECAUSE of sexual liberation of women. Men are mostly responsible...women are typically less responsible. It's men who need the assistance in having their moral rights protected, not undermined by an Alpha state. When the Alpha state has its way... that's when illegitimacy, fornication, etc explode. Men are reduced to their dicks, and women are elevated to beyond above having to take financial and moral responsibility for themselves.
>>29921739
How are women making money off of child support? Children cost a shitload of money to raise. It would be more profitable and take less time to get a job than to raise a kid.
It's like you never stop and think.
>>29922044
You realize the man is the one who chooses to not use a condom right?
Also men have ALWAYS been pursuers. Lrn2biology
>>29922044
>women should like me even though I'm ugly and abrasive
Nice post dork
>>29921914
>implying women does not have a share in the decisions they make
> implying birth is not as intrusive in the womans physiology as the abortion
>implying childless fosterparents cannot help carry the reduced amount of out of wedlock children born
>implying welfare wasnt funding these sad grown womenchilds already
Women must also take a responsibility with protection, but you seem to count them as faultless children
>>29922089
As men we get our choice when we use a condom or not. I've been lucky with 15 years of pulling out too.
This whole crying about child support that virgins do, so they can hate women, is retarded and makes you losers look like you can't take responsibility for your actions.
>>29922071
>You realize the man is the one who chooses to not use a condom right?
As you say in your next like, men are the pursuers. Because women are the pursued. Women have ALL the power in sexual relationships below the age of...60 or so. No woman has to have sex with a man who won't use a condom.
>Also men have ALWAYS been pursuers. Lrn2biology
Men have always pursued women, but there are different ends in mind - for most civilised men who have good reason to believe they won't be suddenly tossed aside and brutalised by the state - the end is a meaningful relationship where they provide (either solely or through sharing) for a woman in a relationship. Sexual liberation, subsidisation of single mothers, and child-support enforcement are all factors in undermining men's capacity to enter a relationship like this, they're left to seeing relationships as transitory, sexual experiences.
>>29922077
A woman doesn't have to like me. She just shouldn't have the right to steal me individually or collectively to subsidise her own irresponsibility. This is an aggression not just against decent men, but against the possibility of decent women too. It's corrupting and evil, it requires the state become violent towards men who most of the time genuinely meant well (child support payments are levied usually against men who at first at least owned up to fatherhood and took responsibility, but were later disposed of).
>>29922116
I don't think you can speak for most men, since you're a virgin and therefore not a man.
As pursuers, we have the total advantage.
>>29922116
How is child support an aggression against decent men? You're sounding like a feminist.
>>29922133
>reducing a man to his sexual component inorder to try and win an arguement due to lack of proper arguements and lack of an intelligent approach to logicbased assesments
Nice you sound like a misandrist, but you arent are you?
Because that in extend would make you retarded, are you retarded?
>>29922133
>I don't think you can speak for most men, since you're a virgin and therefore not a man.
I am a virgin, and I'm more of a man than you'll ever be. I take responsibility for myself. This isn't to judge people like you, though, as you're mostly the product of a particular culture - the culture I'm talking about, which is engineered on your behalf to exploit decent people.
>As pursuers, we have the total advantage.
You have literally no power as a pursuer of women. One wrong move and the same police who are used to imprison men for failing to pay child support is used against you. You have the power to beg for pussy. That's it.
>>29922147
I just explained it. Child support is primarily enforced against men who tried to take responsibility but were 'dismissed' by Little Miss. They're the ones who had or have jobs for the state and women to exploit for their own selfish purposes. The sociopathic alphas don't end up paying child support because they're in and out and gone. Child support is for men who owned up to being fathers, or even in many cases men who assumed for some time a "father type role". It's radically unfair, but men have absolutely no power or voice - feminists argue the opposite, feminists argue that men have more power and voice than women, and this is how they doubly silence and deny men's rights.
>>29922111
This would be fine if i could also decide whether or not the woman keeps the child but i dont. If i dont have that power i refute to take that responsibility because if we are to take equal responsibility we must carry equal power
>outlaw child support
>men who get a 'financial abortion' are required to get a vasectomy to prevent them from fucking up again
Id be okay with that sort of deal.
>>29922221
Id be fine with this if women who choose even a single abortion must have their tubes tied to avoid them fucking up again
Because equal responsibility no?
>>29916189
You're using a transparent false equivalency to defend the logical merit of misogyny? kek that seems about right.
and TOPPER kek, you proved my point because you distinguished "life threatening bacteria," rather than just saying "bacteria" (you're surely retarded so I'll clarify: bacteria here is rhetorically analogous to womankind, life threatening bacteria is rhetorically analogous to "women who are slutty, entitled, and retarded").
And you couldn't even take the time to look up an uncommon life-threatening bacteria? This intellectual laziness baka.
>>29916208
>>29916240
I'd broaden it for efficiency. "I hate 32 year old brunette Libras who are assholes," I'm sure you realize, is a ridiculous thing to say if you just hate assholes.
Sure, it may be off-topic (not really though; it doesn't go off into a tangent, in broadens to encompass the tangent simultaneously) for this thread, but these anons exist and carry their beliefs off of the thread, to other parts of the board and have been brainwashed into adding the unnecessary qualifier of "women" because they don't know how to think for themselves.
>>29905853
HOLY SHIT, that was mine. The OP misspelt "normals" as "normans".
Thank you for saving my picture Anon, please accept this (You).
>>29909342
>emotional thinking
>emotion
>thinking
pick one.
>>29915267
Generalizing is good as long as the overwhelming majority of the population you're making a generalization about fit the generalized statement.
